Rna Quotes

Mai tu sarie amn, tu hae'si, tu kii'rna dae. There is nothing as painful, or as simple, as doing what is right.

I haven't learned How or why Universe contrived to implode And intellectually code The myriadly unique Chromosomically orchestrated DNA-RNA, Quadripartite moleculed, Binary paired, Helically extended And unzippingly dichotomied Regenerative symphonic jazz, as A one and two, Three and four Me---You, Thee---They And more Thine and mine, Sweet citizen, THYMINE-CYTOSINE GUANINE-ADENINE

CRAB—Conservable RNA Augmented Body—the faithful servant for a citizen, as the advertisements from the New World Government say. This parasitic bio-computer, installed in his left wrist, bears his identity.

At one time, we thought that the way life came together was almost completely random, only needing an energy gradient to get going. But as we’ve moved into the information age, we’ve come to realize that life is more about information than energy. Fire has most of the characteristics of life. It eats, it grows, it reproduces. But fire retains no information. It doesn’t learn; it doesn’t adapt. The five millionth fire started by lightning will behave just like the first. But the five hundredth bacterial division will not be like the first one, especially if there is environmental pressure. That’s DNA. And RNA. That’s life. …

I created the Katie Fforde Bursary because I was a "nearly there" writer for a long time. I found it a bit of a struggle to pay my annual subscription to the Romantic Novelists' Association so when I finally became published, I wanted to give something back. That's the bursary, a year's subscription and a place at the conference. It does seem to give people a valuable boost to their confidence. People can find out more about the Romantic Novelists' Association at www.rna-uk.org

This overall flow of genetic information—from DNA to RNA to protein—is known as the central dogma of molecular biology, and it is the language used to communicate and express life.

His thought about the bird halts as the CRAB in his wrist glows. CRAB—Conservable RNA Augmented Body, the faithful servant for a citizen, as the advertisements from the World Government say. This parasitic bio-computer, installed in his left wrist, bears his identity. A hologram projects on it when he fists that hand near his chest. A text message visible in his inbox: You’re missing the Independence Day Speech, auto-signed with Ren. Yuan ignores it. The next text plays in his brain when he is not looking at the CRAB: Come on! The war-hero can’t miss the speech in Alphatech when the war hero himself is its owner! Ren. Yuan doesn’t reply to Ren Agnello, the CEO of Alphatech—the world’s leading transport and robotics industry, of which the Monk is the founder. Well, one of the two founders.

Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).

It is unclear how much longer people will write on dried and flattened wood. Trees do so much for humans and for our planet that it hardly seems fair to ask them to carry our thoughts as well. From "Life from an RNA World: The Ancestor Within.

Matter and energy are equivalent, according to the equation E=mc2, where E stand for energy, m for mass and c for the speed of light,' 'Merapa explained. 'Matter can't be transported at the speed of light but energy can. Therefore, during a time shift transformation, matter is converted to energy then condenses back. In other words all the molecules in your body have been changed from matter to energy then back again.' 'Wow. It's a wonder it's not fatal,' Dirck said. 'Sometimes it is. If any transcription errors occur between the DNA and RNA in your vital organs you're all but dead.

A DNA sequence for the genome of bacteriophage ΦX174 of approximately 5,375 nucleotides has been determined using the rapid and simple 'plus and minus' method. The sequence identifies many of the features responsible for the production of the proteins of the nine known genes of the organism, including initiation and termination sites for the proteins and RNAs. Two pairs of genes are coded by the same region of DNA using different reading frames.

Thomas Cech (pronounced “check”) of the University of Colorado in Boulder, who was using X-ray crystallography in order to explore each nook and cranny of the structure of RNA.

RNA, on the other hand, actually goes out and does real work. Instead of just sitting at home curating information, it makes real products, such as proteins.

Billions of dollars in profits that have resulted for some of those pursuing mRNA research will likely bring more talent, financing, and improvements in the field.

how a piece of RNA could pair up with its phage DNA counterpart and cause that DNA to be destroyed.

What does it mean to live in a world where you have the power to end species by the thousands, but you can also be brought to your knees, or to your end, by a single strand of RNA?

The circular flow of biological information - Genes encode RNAs to build Proteins to form/regulate Organisms that sense Environments that influence Proteins, RNA that regulate Genes.

Caffeine not only dehydrates the body, but also leaches calcium and magnesium, and is an antagonist to the neurotransmitter, adenosine. Adenosine is needed for RNA synthesis (function).

some forms of RNA could likewise be enzymes. Specifically, they found that some RNA molecules can split themselves by sparking a chemical reaction. They dubbed these catalytic RNAs “ribozymes,

RNA (ribonucleic acid) is a molecule in living cells that is similar to DNA (deoxyribonucleic acid), but it has one more oxygen atom in its sugar-phosphate backbone and a difference in one of its four bases.

Doudna’s mission when she arrived at the University of Colorado as a postdoc was to map the intron that Cech had discovered could be a self-splicing piece of RNA, showing all of its atoms, bonds, and shapes.

But she became more interested in DNA’s less-celebrated sibling, RNA. It’s the molecule that actually does the work in a cell by copying some of the instructions coded by the DNA and using them to build proteins.

Apart from a few viruses, all life on Earth now relies on DNA to hold the information that it needs to reproduce. But the most likely players in the first games of life were molecules of the related genetic material RNA, which is more flexible than DNA because it can both carry information down the generations and also catalyze—speed up—chemical reactions, a very handy feat. And RNA still carries out all kinds of critical roles in organisms that are described by DNA, including human beings.

A small segment of DNA that encodes a gene is transcribed into a snippet of RNA, which then travels to the manufacturing region of the cell. There this “messenger RNA” facilitates the assembly of the proper sequence of amino acids to make a specified protein.

What does it mean to live in a world where you have the power to end species by the thousands, but you can also be brought to your knees, or to your end, by a single strand of RNA?[...]the only conclusion I can draw is a simple one: We are so small, and so frail, so gloriously and terrifyingly temporary.

An arcane microbial defense, devised by microbes, discovered by yogurt engineers, and reprogrammed by RNA biologists, has created a trapdoor to the transformative technology that geneticists had sought so longingly for decades: a method to achieve directed, efficient, and sequence-specific modification of the human genome.

It turns out that tracrRNA performs two important tasks. First, it facilitates the making of the crRNA, the sequence that carries the memory of a virus that previously attacked the bacteria. Then it serves as a handle to latch on to the invading virus so that the crRNA can target the right spot for the Cas9 enzyme to chop.

It also showed that the only real block to bi-maternal reproduction is the DNA methylation pattern at key genes. It disproved a previous hypothesis that sperm were required because the sperm themselves carried certain necessary accessory factors such as particular proteins or RNA molecules required to kick-start development properly.16

When the genetic code was solved, in the early 1960s, it turned out to be full of redundancy. Much of the mapping from nucleotides to amino acids seemed arbitrary—not as neatly patterned as any of Gamow’s proposals. Some amino acids correspond to just one codon, others to two, four, or six. Particles called ribosomes ratchet along the RNA strand and translate it, three bases at a time. Some codons are redundant; some actually serve as start signals and stop signals. The redundancy serves exactly the purpose that an information theorist would expect. It provides tolerance for errors. Noise affects biological messages like any other. Errors in DNA—misprints—are mutations.

It was a biochemical Jackson Pollock: a field of strings, tangles, loops.

Influenza is caused by three types of viruses, of which the most worrisome and widespread is influenza A. Viruses of that type all share certain genetic traits: a single-stranded RNA genome, which is partitioned into eight segments, which serve as templates for eleven different proteins. In other words, they have eight discrete stretches of RNA coding, linked together like eight railroad cars, with eleven different deliverable cargoes. The eleven deliverables are the molecules that comprise the structure and functional machinery of the virus. They are what the genes make. Two of those molecules become spiky protuberances from the outer surface of the viral envelope: hemagglutinin and neuraminidase. Those two, recognizable by an immune system, and crucial for penetrating and exiting cells of a host, give the various subtypes of influenza A their definitive labels: H5N1, H1N1, and so on. The term “H5N1” indicates a virus featuring subtype 5 of the hemagglutinin protein combined with subtype 1 of the neuraminidase protein. Sixteen different kinds of hemagglutinin, plus nine kinds of neuraminidase, have been detected in the natural world. Hemagglutinin is the key that unlocks a cell membrane so that the virus can get in, and neuraminidase is the key for getting back out. Okay so far? Having absorbed this simple paragraph, you understand more about influenza than 99.9 percent of the people on Earth. Pat yourself on the back and get a flu shot in November. At

medicine hadn’t really changed much since the days of leeches and poultices; nowadays they whirred one in centrifuges, realigned the body’s magnetic field, bombarded the victim with sonic waves, tapped into the cells to interrogate the RNA, and then admitted their ignorance without actually coming out and saying so. The only thing that had changed was that the bills were bigger.

RNA interference operates by deploying an enzyme known as “Dicer.” Dicer snips a long piece of RNA into short fragments. These little fragments can then embark on a search-and-destroy mission: they seek out a messenger RNA molecule that has matching letters, then they use a scissors-like enzyme to chop it up. The genetic information carried by that messenger RNA is thus silenced.

In fact, the CDC would later implicitly acknowledge the system’s value when it admitted in June that the mRNA vaccines could cause myocarditis—a potentially serious heart problem—in young men. Side effect reports from VAERS formed the core of the agency’s analysis.37 Yet even after that finding, the stories dismissing the value of the VAERS reports went on.38 I am not an “anti-vaxxer.

Doudna wrote in a scholarly publication back in 2013, researchers hoped to find ways to use RNA interference to protect humans from infections.6 Two papers published in Science that year gave strong evidence that it might work. The hope then was that drugs based on RNA interference might someday be a good option for treating severe viral infections, including those from new coronaviruses

Let me put a little makeup on,” I said to him. “You don’t need it, come.” He held out his hand. “At least let me make sure my hair is tidy,” I said in a slightly irritated tone. “You’re perfect, and it’s already seven.

Nature isn’t benign,” Lederberg said at the meeting’s opening. “The bottom lines: the units of natural selection—DNA, sometimes RNA elements—are by no means neatly packaged in discrete organisms. They all share the entire biosphere. The survival of the human species is not a preordained evolutionary program. Abundant sources of genetic variation exist for viruses to learn new tricks, not necessarily confined to what happens routinely, or even frequently.

Through much resistance on my part, you made it easy, and it was so different from basic relationships or familial love. I didn’t know what it was about you that made things so peculiar. You talk about your scent fetish, but as it turned out, I was also addicted to yours. It wasn’t a game for me, and I felt it much deeper than I can probably even describe in words—the combining of souls. If you weren’t around, I found myself missing you; I found myself needing you. My body, my mind, and my spirit need you. I am the world’s biggest fool, the biggest pain in the ass, but I’m stupidly, unapologetically, and whole-heartedly in love with you. I’ve waited so long to tell you that."-Tara

Kısa bir süre sonra bakteri savunma sisteminin en az iki kritik bileşen içerdiği anlaşıldı. Bunlardan birincisi ''arayıcı'' idi - virüsün DNA'sıyla örtüşerek tanıyan bakteri RNA'sı. Bu tanıma ilkesi de hayret vericiydi: ''Arayıcı'' RNA, virüs DNA'sının ayna görüntüsüydü - yin ve yang gibi. Böylece istilacı virüsün DNA'sını fark edebiliyordu. Düşmanın resmini sürekli cebinde taşır gibi veya bakteri örneğinde, düşmanın resminin negatifini genomunda taşır gibi.

In the late 1970s, scientists working on gene-silencing discovered that the attachment of a small molecule-a methyl group-to DNA was correlated with a gene's turning off. These methyl tags decorated the strands of DNA, like charms on a necklace, and they were recognized as shutdown signals. The production of RNA ceased and the expression of the gene was silenced. If a chromosome was heavily decorated by methyl tags, then perhaps the whole chromosome could be silenced.

Dr. Mackay said that this idea is actually somewhat reasonable, from a purely biological point of view. He said that rhinoviruses—and other RNA respiratory viruses—are completely eliminated from the body by the immune system; they do not linger after infection. Furthermore, we don’t seem to pass any rhinoviruses back and forth with animals, which means there are no other species that can serve as reservoirs of our colds. If rhinoviruses don’t have enough humans to move between, they die out.

It’s a combination of the pseudouridine incorporating into the RNA and the toxicity of the lipids and the toxicity of the complexes as a whole, which is separate from the toxicity of the spike. So, we’ve really got three categories of toxicities. We got the payload toxicity—that’s your spike issues. We got the cationic lipid and associated nanoplex toxicity. And we have the toxicity of the pseudouridine incorporating molecule, which is not really a natural RNA; it’s something else altogether.

Years ago, however, with the development of lipid nanoparticles (LNPs), molecules were found that could act as brain-penetrating packaging material; that is, they could cross the blood-brain barrier. Their original use was to deliver chemotherapeutic drugs to the brain for the treatment of brain tumors (see sidebar Brain Toxic Packaging).37 It was no secret that LNPs could also be used to deliver genetic material in the form of DNA or mRNA to the brain or brain cells to become biologically active.

The word epigenetics literally means “above the gene.” It refers to the control of genes not from within the DNA itself but from messages coming from outside the cell—in other words, from the environment. These signals cause a methyl group (one carbon atom attached to three hydrogen atoms) to attach to a specific spot on a gene, and this process (called DNA methylation) is one of the main processes that turns the gene off or on. (Two other processes, covalent histone modification and noncoding RNA, also turn genes on and off,

The CRISPR-based tests developed by Mammoth and Sherlock are cheaper and faster than conventional PCR tests. They also have an advantage over antigen tests, such as the one developed by Abbott Labs that was approved in August of the plague year. The CRISPR-based tests can detect the presence of the RNA of a virus as soon as a person has been infected. But the antigen tests, which detect the presence of proteins that exist on the surface of the virus, are most accurate only after a patient has become highly infectious to others.

Viruses are just single strands of RNA or DNA lying around. They can’t replicate until and unless they find a cell to hijack. So they aren’t alive, but they also aren’t not alive. Once a virus invades a cell, it does what life does—it uses energy to make more of itself. Viruses remind me that life is more of a continuum than a duality. Sure, viruses aren’t living, because they need host cells to replicate. But then again, many bacteria also can’t survive without hosts, and stranger still, many hosts can’t survive without bacteria.

Genetik kod basittir: DNA'dan RNA inşa edilir, RNA'dan da protein inşa edilir. DNA'daki her baz üçlüsü, proteinde bir aminoasidi belirler. Oysa genomik kod karmaşıktır: Genin üzerinde, genin ne zaman ve nerede ifade edileceği ile ilgili bilgileri barındıran DNA parçaları vardır: Genlerin genom üzerindeki yerlerinin neye göre belirlenmiş olduğunu da bilmiyoruz. Genler arasındaki DNA bölgelerinin gen fizyolojisini nasıl düzenlediğini ve koordine ettiğini de bilmiyoruz. Dağların ötesinde dağların olması gibi, kodların ötesinde de kodlar vardır.

RNA viruses are limited to small genomes because their mutation rates are so high, and their mutation rates are so high because they’re limited to small genomes. In fact, there’s a fancy name for that bind: Eigen’s paradox. Manfred Eigen is a German chemist, a Nobel winner, who has studied the chemical reactions that yield self-organization of longer molecules, a process that might lead to life. His paradox describes a size limit for such self-replicating molecules, beyond which their mutation rate gives them too many errors and they cease to replicate. They die out. RNA

دل لالچی ہے۔ دل فتنہ پسند ہے۔ دل بہانے باز ہے۔ آخر انسان کا دل غلط کام کرنے کے لیے اتنا للچاتا کیوں ہے؟ بیماری میں بد پرہیزی کھانا کھانے کے لیے۔ انٹرنیٹ پر خوامخواہ وقت ضائع کرنے کے لیے۔ بے پردگی کی حدود میں داخل نئے فیشن کے لیے۔ غیر اسلامی کپڑے اور عادات و اطوار اپنانے کے لئے۔ ایسا کوئی دن نہیں جاتا جب کسی سماجی، معاشرتی، مذہبی اصول کو توڑنے کا خیال دل میں نہ آئے۔دل کا یہ بہلاوا کہ یہ تو ایک چھوٹی سی بے ضرر سی بات ہے۔ اسلام کے خلاف نہیں۔ کوئی یہ نہیں سمجھتا کہ چھوٹی چھوٹی غلطیاں کرتے کرتے ، بڑے گناہ بھی چھوٹے لگنے لگتے ہیں۔ شبانہ مختار کے ناول 'بچھڑنا نصیب تھا' سے اقتباس

Primitive “bondmaker” molecules, early precursors of the RNA system, which bind nucleotides together, came into existence way before the first cells. So, too, did bondmaker molecules that developed the ability to join nucleotides together following a template—“copymakers.” These bondmakers and copymakers came into existence through random molecular re-sorting. It was the existence of copymaker molecules that set the process of evolution into motion. Natural selection chiseled living things into existence, but the requisite molecules for evolution—the bondmakers and copymakers—existed before life itself.

of now, the main difference has been found in the HAR1 (human accelerated region 1), a segment of a recently discovered RNA gene. The RNA that is expressed in early development (HAR1F) is specific to the reelin-producing Cajal-Retzius cells in the brain. HAR1F comes to expression together with reelin in the seventeenth to nineteenth weeks of fetal development, a crucial stage in the formation of the six-layered cerebral cortex. The mutations in this human gene are probably over a million years old and could have played a crucial role in the emergence of modern humankind. Throughout our evolution, an enormous

What is that 95 percent? Some is junk—remnants of pseudogenes inactivated by evolution.fn4,3 But buried in that are the keys to the kingdom, the instruction manual for when to transcribe particular genes, the on/off switches for gene transcription. A gene doesn’t “decide” when to be photocopied into RNA, to generate its protein. Instead, before the start of the stretch of DNA coding for that gene is a short stretch called a promoterfn5—the “on” switch. What turns the promoter switch on? Something called a transcription factor (TF) binds to the promoter. This causes the recruitment of enzymes that transcribe the gene into RNA. Meanwhile, other transcription factors deactivate genes.

Why has DNA had a monopoly on molecular symbolism over the past few hundreds of millions of years? In its physical manifestation, DNA is extremely structurally stable, unlike RNA. This has helped DNA remain the symbolic structure of choice throughout evolution. However, while the DNA in our cells and the cells of other living organisms is now very stable, the structure of DNA did not start out that way at the very origins of life. Random shuffling and re-sorting of molecules, through the irreversible and probabilistic process of natural selection, generated molecules resembling nucleotide bases. Through subsequent shuffling, successful DNA components and sequences survived and replicated.

At one time, we thought that the way life came together was almost completely random, only needing an energy gradient to get going. But as we’ve moved into the information age, we’ve come to realize that life is more about information than energy. Fire has most of the characteristics of life. It eats, it grows, it reproduces. But fire retains no information. It doesn’t learn; it doesn’t adapt. The five millionth fire started by lightning will behave just like the first. But the five hundredth bacterial division will not be like the first one, especially if there is environmental pressure. That’s DNA. And RNA. That’s life. … Dr. Steven Carlisle, from the Convention panel Exploring the Galaxy

Shadow is the blue patch where the light doesn’t hit. It is mystery itself, and mystery is the ancients’ ultima Thule, the modern explorer’s Point of Relative Inaccessibility, that boreal point most distant from all known lands. There the twin oceans of beauty and horror meet. The great glaciers are calving. Ice that sifted to earth as snow in the time of Christ shears from the pack with a roar and crumbles to water. It could be that our instruments have not looked deeply enough. The RNA deep in the mantis’s jaw is a beautiful ribbon. Did the crawling Polyphemus moth have in its watery heart one cell, and in that cell one special molecule, and that molecule one hydrogen atom, and round that atom’s nucleus one wild, distant electron that split showed a forest, swaying?

Here I should issue a caveat. In origins-of-life research (and probably in most other disciplines as well), scientists gravitate to models that highlight their personal scientific specialty. Organic chemist Stanley Miller and his cohorts saw life’s origins as essentially a problem in organic chemistry. Geochemists, by contrast, have tended to focus on more intricate origins scenarios involving such variables as temperature and pressure and chemically complex rocks. Experts in membrane-forming lipid molecules promote the “lipid world,” while molecular biologists who study DNA and RNA view the “RNA world” as the model to beat. Specialists who study viruses, or metabolism, or clays, or the deep biosphere have their idiosyncratic prejudices as well. We all do it; we all focus

Genes, oddly, compromise only a minuscule fraction of it. An enormous proportion-a bewildering 98 percent-is not dedicated to genes per se, but to enormous stretches of DNA that are interspersed between genes (intergenic DNA) or within genes (introns). These long stretches encode no RNA, and no protein: they exist in the genome either because they regulate gene expression, or for reasons that we do not yet understand, or because of no reason whatsoever (i.e., they are "junk" DNA). If the genome were a line stretching across the Atlantic Ocean between North America and Europe, genes would be occasional specks of land strewn across long, dark tracts of water. Laid end to end, these specks would be no longer than the largest Galapagos island or a train line across the city of Tokyo,

During replication, those nucleotides are read and translated into linear strings of amino acids (which make up enzymes and proteins) by a rule-governed process. The set of rules is called the genetic code. The DNA contains the sequence, but the code is implemented by RNA molecules. Certain DNA sequences, called codons, which are made up of three nucleotides, symbolize certain amino acid sequences. There is no ambiguity, but there is also not just one codon for each amino acid. For example, six different codons symbolize arginine, but only one codon symbolizes tryptophan. But the components of the DNA sequence (the symbol) do not resemble the components of the amino acid sequence (its meaning), just as the words that symbolize the components of a recipe do not resemble the components themselves.

The third cardinal feature of gene regulation, Monod and Jacob discovered, was that every gene had specific regulatory DNA sequences appended to it that acted like recognition tags. Once a sugar sensing-protein had detected sugar in the environment, it would recognize one such tag and turn the target genes on or off. That was a gene's signal to make more RNA messages and thereby generate the relevant enzyme to digest the sugar. A gene, in short, possessed not just information to encode a protein, but also information about when and where to make that protein. All that data was encrypted in DNA, typically appended to the front of every gene (although regulatory sequences) an also be appended to the ends and middle of genes). The combination of regulatory sequences and the protein-encoding sequence defined a gene.

The DNA-RNA apparatus isn't the whole secret of life, but a sort of computer program by which the real secret, the control system, ex-presses its pattern in terms of living cells.This pattern is part of what many people mean by the soul, which somany philosophies have tried to explicate. However, most of the pro-posed answers haven't been connected with the physical world of biology in a way that offered a toehold for experiment. Like many attempts, the latest major scientific guess, the morphogenetic field proposed by Paul Weiss in 1939, was just a restatement of the problem, though a useful one. Weiss conjectured that development was guided by some sort of field projected from the fertilized egg. As the dividing cell mass became an embryo and then an adult, the field changed its shape and somehow led the cells onward.

The DNA is made up of two opposite spirals, positive and negative, which can easily be considered isomorphic to I Ching's yin () and yang (), or Leibniz's 0 and 1, or Joyce's and . These are bonded by four amino acids—adenine, guanine, cytosine and thymine, which are usually abbreviated A, G, C, T. If one dares to consider these isomorphic with active yang (), passive yang (), active yin () and passive yin (), or Leibniz's 01,11,10 and 00, or Joyce's and , then the parallel becomes staggering. In forming RNA messages—the genetic code—the T (thymine) drops out to be replaced by U (uracil) but we still have four elements—A, G, C, U—and if we permutate them by the now-familiar rule, making all possible combinations of three out of these basic four "letters," we get again 43 or 64 "words," which are the 64 elements of the genetic language.

I guess you’ll have to keep visiting me then,” I said playfully. He nuzzled his face into my neck, and I giggled quietly. “Do you mean that?” He asked, searching my face for answers shortly after. “If I didn’t, would I have even offered? Also, if I said no, would that really stop you?” I smirked, and he smiled playfully. “True, but if I knew you really meant it, I would leave you alone even if it went against all my instincts.

How does the body push the comparatively tiny genome so far? Many researchers want to put the weight on learning and experience, apparently believing that the contribution of the genes is relatively unimportant. But though the ability to learn is clearly one of the genome's most important products, such views overemphasize learning and significantly underestimate the extent to which the genome can in fact guide the construction of enormous complexity. If the tools of biological self-assembly are powerful enough to build the intricacies of the circulatory system or the eye without requiring lessons from the outside world, they are also powerful enough to build the initial complexity of the nervous system without relying on external lessons. The discrepancy melts away as we appreciate the true power of the genome. We could start by considering the fact that the currently accepted figure of 30,000 could well prove to be too low. Thirty thousand (or thereabouts) is, at press time, the best estimate for how many protein-coding genes are in the human genome. But not all genes code for proteins; some, not counted in the 30,000 estimate, code for small pieces of RNA that are not converted into proteins (called microRNA), of "pseudogenes," stretches of DNA, apparently relics of evolution, that do not properly encode proteins. Neither entity is fully understood, but recent reports (from 2002 and 2003) suggest that both may play some role in the all-important process of regulating the IFS that control whether or not genes are expressed. Since the "gene-finding" programs that search the human genome sequence for genes are not attuned to such things-we don't yet know how to identify them reliably-it is quite possible that the genome contains more buried treasure.

A virus particle is a very small capsule made of proteins locked together in a mathematical pattern. The pattern of the interlocking proteins in a virus is far more complicated than a snowflake. The protein capsule is sometimes wrapped in an oily membrane. Inside the capsule there is a small amount of DNA or RNA, the molecules that contain the genetic code of the virus. The genetic code is the virus’s operating system, or wetware, the complete set of instructions for the virus to make copies of itself. Unlike a snowflake or any other kind of crystal, a virus is able to re-create its form. It would be as if a single snowflake started copying itself as it falls, and those copies of the snowflake copy themselves, creating ever-growing numbers of identical copies of the first snowflake, until the air is filled with falling snow, and each flake is a perfect replica of the first flake.

Recently scientists have found that cephalopods (the family that contains the octopus) can recode their RNA. RNA molecules have the privilege of establishing codes with DNA (in the part of the RNA that recognizes the three-nucleotide DNA codon sequence) and also with proteins (in the separate part of the RNA that recognizes the amino acid). Recoding the RNA means that new proteins can be constructed while the DNA sequence of symbols stays the same. The collective result is the destruction of the one-to-one gene-to-protein correspondence. Recoding allows a single octopus gene to produce many different types of proteins from the same DNA sequence.18 This is a big deal. It is evidence against the three concepts in biology that dismiss semiotic systems in living organisms. The system can change its code. The system has an internal codemaker that can produce biological innovations—new proteins—but not via natural selection. It illustrates the arbitrariness of the connection of a symbol with its meaning in a living system. If symbols within living systems

Superimposed on the hierarchical framework of defined components of a cell there is another layer. This second layer is highly flexible and can take on an almost infinite variety of forms, like soft and responsive flesh on a bony skeleton. The deep question is whether this higher layer in the construction of cells is itself organized. Are there hierarchies, or at least rules, in the protein-modifying, RNA splicing, gene-regulating processes of a cell? If so, then we have a chance of understanding them. If not, we will never know exactly what a cell will do next. If the detailed chemistry of the cell is simply the outcome of a historical ragbag of ad hoc interactions, then it will be no more predictable than the weather. I do not have an answer to this question. But two features of cells might be relevant. One is a sense of time, or causation - knowledge of the way that things in the real world follow in a certain sequence. The other is integrity, which enables a cell to distinguish between what belongs to itself and what belongs to the outside world.

The bacterial defense system was soon found to involve at least two critical components. The first piece was the "seeker"-an RNA encoded in the bacterial genome that matched and recognized the DNA of the viruses. The principle for the recognition, yet again, was binding: the RNA "seeker" was able to find and recognize the DNA of an invading virus because it was a mirror image of that DNA-the yin to its yang. It was like carrying a permanent image of your enemy in your pocket-or, in the bacteria's case, an inverted photograph, etched indelibly into its genome. The second element of the defense system was the "hitman." Once the viral DNA had been recognized and matched as foreign (by its reverse-image), a bacterial protein named Cas9 was deployed to deliver the lethal gash to the viral gene. The "seeker" and the "hitman" worked in concert: the Cas9 protein delivered its cuts to the genome only after the sequence had been matched by the recognition element. It was a classic combination of collaborators-spotter and executor, drone and rocket, Bonnie and Clyde.

It was the magnesium. The addition of the ion was critical: with the solution supplemented with magnesium, the ribosome remained glued together, and Brenner and Jacob finally purified a miniscule amount of the messenger molecule out of bacterial cells. It was RNA, as expected-but RNA of a special kind. The messenger was generated afreah when a gene was translated. Like DNA, these RNA molecules were built by stringing together four bases-A,G,C, and U (in the RNA copy of a gene, remember, the T found in DNA is substituted for U). Notably, Brenner and Jacob later discovered the messenger RNA was a facsimile of the DNA chain-a copy made from the original. The RNA copy of a gene then moved from the nucleus to the cytosol, where its message was decoded to build a protein. The messenger RNA was neither an inhabitant of heaven nor of hell-but a professional go-between. The generation of an RNA copy of a gene was termed transcription-referring to the rewriting of a word or sentence in a language close to the original. A gene's code (ATGGGCC...) was transcribed into an RNA code (AUGGGCC...).

is dynamic. “Experts” frequently differ on scientific questions and their opinions can vary in accordance with and demands of politics, power, and financial self-interest. Nearly every lawsuit I have ever litigated pitted highly credentialed experts from opposite sides against each other, with all of them swearing under oath to diametrically antithetical positions based on the same set of facts. Telling people to “trust the experts” is either naive or manipulative—or both. All of Dr. Fauci’s intrusive mandates and his deceptive use of data tended to stoke fear and amplify public desperation for the anticipated arrival of vaccines that would transfer billions of dollars from taxpayers to pharmaceutical executives and shareholders. Some of America’s most accomplished scientists, and the physicians leading the battle against COVID in the trenches, came to believe that Anthony Fauci’s do-or-die obsession with novel mRNA vaccines—and Gilead’s expensive patented antiviral, remdesivir—prompted him to ignore or even suppress effective early treatments, causing hundreds of thousands of unnecessary deaths while also prolonging the pandemic

Second, the production of RNA Messages was coordinately regulated. When the sugar source was switched to lactose, the bacteria turned on an entire module of genes-several lactose-metabolizing genes-to digest lactose. One of the genes in the module specified a "transporter protein" that allowed lactose to enter the bacterial cell. Another gene encoded an enzyme that was needed to break down lactose into parts. Yet another specified an enzyme to break those chemical parts into subparts. Surprisingly, all the genes dedicated to a particular metabolic pathway were physically present next to each other on the bacterial chromosome-like library books stacked by subject-and they were induced simultaneously in cells. The metabolic alteration produced a profound genetic alteration in a cell. It wasn't just a cutlery switch; the whole dinner service was altered in a single swoop. A functional circuit of genes was switched on and off, as if operated by a common spool or a master switch. Monod called one such gene module an operon. The genesis of proteins was thus perfectly synchronized with the requirements of the environment: supply the correct sugar, and a set of sugar-metabolizing genes would be turned on together.

Through much resistance on my part, you made it easy, and it was so different from basic relationships or familial love. I didn’t know what it was about you that made things so peculiar. You talk about your scent fetish, but as it turned out, I was also addicted to yours. It wasn’t a game for me, and I felt it much deeper than I can probably even describe in words—the combining of souls. If you weren’t around, I found myself missing you; I found myself needing you. My body, my mind, and my spirit need you. I am the world’s biggest fool, the biggest pain in the ass, but I’m stupidly, unapologetically, and whole-heartedly in love with you. I’ve waited so long to tell you that." -Tara

Working independently, Baltimore and Temin discovered an enzyme found in retroviruses that could build DNA from an RNA template. They called the enzyme reverse transcriptase-"reverse" because it inverted the normal direction of information flow: from RNA back to DNA, or from a gene's message backward to a gene, thereby violating Crick's "central dogma" (that genetic information only moved from genes to messages, but never backward). Using reverse transcriptase, ever RNA in a cell could be used as a template to build its corresponding gene. A biologist could thus generate a catalog, or "library" of all "active" genes in a cell-akin to a library of books grouped by subject. There would be a library of genes for T cells and another for red blood cells, a library for neurons in the retina, for insulin-secreting cells of the pancreas, and so forth. By comparing libraries derived from two cells-a T cell and a pancreas cell, say-an immunologist could fish out genes that were active in one cell and not the other (e.g., insulin or the T cell receptor). Once identified, that gene could be amplified a millionfold in bacteria. The gene could be isolated and sequenced, its RNA and protein sequence determined, its regulatory regions identified; it could be mutated an inserted into a different cell to decipher the gene's structure and function. In 1984 this technique was deployed to clone the T cell receptor-a landmark achievement in immunology.

As an anology, consider the word structure. In bacteria, the gene is embedded in the genome in precisely that format, structure, with no breaks, stuffers, interpositions, or interruptions. In the human genome, in contrast, the word is interrupted by intermediate stretches of DNA: s...tru...ct...ur...e. The long stretches of DNA marked by the ellipses (...) do not contain any protein-encoding information. When such an interrupted gene is used to generate a message-i.e., when DNA is used to build RNA-the stuffer frragments are excised from the RNA message, and the RNA is stitched together again with the intervening pieces removed: s...tru...ct...ur...e became simplified to structure. Roberts and Sharp later coined a phrase for the process: gene splicing or RNA splicing (since the RNA message of the gene was "spliced" to removed the stuffer fragments). At first, this split structure of genes seemed puzzling: Why would an animal genome waste such long stretches of DNA splitting genes into bits and pieces, only to stitch them back into a continuous message? But the inner logic of split genes soon became evident: by splitting genes into modules, a cell could generate bewildering combinations of messages out of a single gene. The word s...tru...c...t...ur...e can be spliced to yield cure and true and so forth, thereby creating vast numbers of variant messages-called isoforms-out of a single gene. From g...e...n...om...e you can use splicing to generate gene, gnome, and om. And modular genes also had an evolutionary advantage: the individual modules from different genes could be mixed and matched to build entirely new kinds of genes (c...om...e...t). Wally Gilbert, the Harvard geneticist, created a new word for these modules; he called them exons. The inbetween stuffer fragments were termed introns.

Flagyl was clearly effective in the treatment of Lyme disease. But how did it work? As early as 1967 The British Journal of Venereal Diseases had published a study showing Flagyl to be effective in certain cases of syphilis, and that it had an effect on bacterial DNA and RNA irrespective of bacterial replication. Could this be the mechanism of Flagyl’s action against Burrelia burgdorferi? The key to Flagyl’s effectiveness on Lyme, however, was not reported until several months after my study was presented. Dr. O. Brorson, a Norwegian researcher, published a paper on Flagyl and its effect on the cystic forms of Lyme disease six months after I presented my research. The cystic form of Lyme disease, it turns out, is one mechanism that Borrelia burgdorferi utilizes to persist in the body. Dr. Brorson reported that Flagyl would cause Borrelia cysts to rupture, and he went on to publish that he could see under the microscope the cell wall forms of Borrelia burgdorferi (helical/spiral–shaped organisms) transform into cystic forms, and under proper conditions convert back into mobile spirochetes. A review of the medical literature revealed that these cystic forms had, in fact, been reported in syphilis. No one had clearly made the link between Borrelia and a cystic form of the organism that could persist for long periods of time in a dormant state. It was a highly evolved survival mechanism that would allow the organism to reemerge when conditions were optimal. My patient, Mary, had been treated initially with Plaquenil, which according to Dr. Brorson’s research also affects the cystic forms, yet it appeared that it was not powerful enough to destroy the dormant forms and prevent a relapse, or to prevent her from passing it on to her fetus. She had also been treated with drugs that addressed the cell wall and intracellular forms of Lyme. Although Plaquenil has some effect on cystic forms, it is often primarily used in antibiotic regimens with Lyme disease to alkalize the intracellular compartment, modulate autoimmune reactions, and affect essential enzymes necessary for bacterial replication. Clearly, however, it is not powerful enough to destroy enough of the

A virus particle is a very small capsule made of proteins locked together in a mathematical pattern. The pattern of the interlocking proteins in a virus is far more complicated than a snowflake. The protein capsule is sometimes wrapped in an oily membrane. Inside the capsule there is a small amount of DNA or RNA, the molecules that contain the genetic code of the virus. The genetic code is the virus’s operating system, or wetware, the complete set of instructions for the virus to make copies of itself. Unlike a snowflake or any other kind of crystal, a virus is able to re-create its form. It would be as if a single snowflake started copying itself as it falls, and those copies of the snowflake copy themselves, creating ever-growing numbers of identical copies of the first snowflake, until the air is filled with falling snow, and each flake is a perfect replica of the first flake. Many virologists feel that viruses are not truly living things. At the same time, viruses are obviously not dead. Virologists like to describe them as life forms. The term is a contradiction: How can something be a form of life that isn’t alive? Viruses carry on their existence in a misty borderland that lies between life and death, a gray zone where the things we encounter are neither provably alive nor certainly dead. One way to understand viruses is to think about them as biological machines. A virus is a wet nanomachine, a tiny, complicated, slightly fuzzy mechanism, which is rubbery, flexible, wobbly, and often a little bit imprecise in its operation—a microscopic nugget of squishy parts. Viruses are subtle, logical, tricky, reactive, devious, opportunistic. They are constantly evolving, their forms steadily changing as time passes. Like all kinds of life, viruses possess a relentless drive to reproduce themselves so that they can persist through time. When a virus starts copying itself strongly and rapidly in a host, the process is called virus amplification. As a virus amplifies itself in its host, the host, a living organism, can be destroyed. Viruses are the undead of the living world, the zombies of deep time. Nobody knows the origin of viruses—how they came into existence or when they appeared in the history of life on earth. Viruses may be examples or relics of life forms that operated at the dawn of life. Viruses may have come into existence with the first stirrings of life on the planet, roughly four billion years ago. Or they may have arisen after life started, during the time when single-celled bacteria had already come into existence—nobody knows.

The trends speak to an unavoidable truth. Society's future will be challenged by zoonotic viruses, a quite natural prediction, not least because humanity is a potent agent of change, which is the essential fuel of evolution. Notwithstanding these assertions, I began with the intention of leaving the reader with a broader appreciation of viruses: they are not simply life's pathogens. They are life's obligate partners and a formidable force in nature on our planet. As you contemplate the ocean under a setting sun, consider the multitude of virus particles in each milliliter of seawater: flying over wilderness forestry, consider the collective viromes of its living inhabitants. The stunnig number and diversity of viruses in our environment should engender in us greater awe that we are safe among these multitudes than fear that they will harm us. Personalized medicine will soon become a reality and medical practice will routinely catalogue and weigh a patient's genome sequence. Not long thereafter one might expect this data to be joined by the patient's viral and bacterial metagenomes: the patient's collective genetic identity will be recorded in one printout. We will doubtless discover some of our viral passengers are harmful to our health, while others are protective. But the appreciation of viruses that I hope you have gained from these pages is not about an exercise in accounting. The balancing of benefit versus threat to humanity is a fruitless task. The viral metagenome will contain new and useful gene functionalities for biomedicine: viruses may become essential biomedical tools and phages will continue to optimize may also accelerate the development of antibiotic drug resistance in the post-antibiotic era and emerging viruses may threaten our complacency and challenge our society economically and socially. Simply comparing these pros and cons, however, does not do justice to viruses and acknowledge their rightful place in nature. Life and viruses are inseparable. Viruses are life's complement, sometimes dangerous but always beautiful in design. All autonomous self-sustaining replicating systems that generate their own energy will foster parasites. Viruses are the inescapable by-products of life's success on the planet. We owe our own evolution to them; the fossils of many are recognizable in ERVs and EVEs that were certainly powerful influences in the evolution of our ancestors. Like viruses and prokaryotes, we are also a patchwork of genes, acquired by inheritance and horizontal gene transfer during our evolution from the primitive RNA-based world. It is a common saying that 'beauty is in the eye of the beholder.' It is a natural response to a visual queue: a sunset, the drape of a designer dress, or the pattern of a silk tie, but it can also be found in a line of poetry, a particularly effective kitchen implement, or even the ruthless efficiency of a firearm. The latter are uniquely human acknowledgments of beauty in design. It is humanity that allows us to recognize the beauty in the evolutionary design of viruses. They are unique products of evolution, the inevitable consequence of life, infectious egotistical genetic information that taps into life and the laws of nature to fuel evolutionary invention.

Although we fully understand the genetic code-i.e., how the information in a single gene is used to build a protein-we comprehend virtually nothing of the genomic code-i.e., how multiple genes spread across the human genome coordinate gene expression in space and time to build, maintain, and repair a human organism. The genetic code is simple: DNA is used to build RNA, and RNA is used to build a protein. A triplet of bases in DNA specifies one amino acid in the protein. The genomic code is complex: appended to a gene are sequences of DNA that carry information on when and where to express the gene. We do not know why certain genes are located in particular geographic locations in the genome, and how the tracts of DNA that lie between genes regulate and coordinate gene physiology. There are codes beyond codes, like mountains beyond mountains.

If you stop and think through what it means to grow, the process is astonishing. Each part of the body has to change its shape and size to match every other part. There’s no central blueprint for the construction of an adult human. Each cell has to decide for itself, using nothing more than chemical signals and its own network of genes, RNA molecules, and proteins.

Cara Mengobati HIV Meskipun sampai saat ini belum ada obat untuk menyembuhkan HIV, namun ada jenis obat yang dapat memperlambat perkembangan virus. Jenis obat ini disebut antiretroviral (ARV). ARV bekerja dengan menghilangkan unsur yang dibutuhkan virus HIV untuk menggandakan diri, dan mencegah virus HIV menghancurkan sel CD4. Beberapa jenis obat ARV, antara lain: Efavirenz Etravirine Nevirapine Lamivudin Zidovudin Selama mengonsumsi obat antiretroviral, dokter akan memonitor jumlah virus dan sel CD4 untuk menilai respons pasien terhadap pengobatan. Hitung sel CD4 akan dilakukan tiap 3-6 bulan. Sedangkan pemeriksaan HIV RNA dilakukan sejak awal pengobatan, dilanjutkan tiap 3-4 bulan selama masa pengobatan. Untuk Info Segera Hubungi Kami HP/WA 081 329 878 999 Pasien harus segera mengonsumsi ARV begitu didiagnosis menderita HIV, agar perkembangan virus HIV dapat dikendalikan. Menunda pengobatan hanya akan membuat virus terus merusak sistem kekebalan tubuh dan meningkatkan risiko penderita HIV terserang AIDS. Selain itu, penting bagi pasien untuk mengonsumsi ARV sesuai petunjuk dokter. Melewatkan konsumsi obat akan membuat virus HIV berkembang lebih cepat dan memperburuk kondisi pasien. Bila pasien melewatkan jadwal konsumsi obat, segera minum begitu ingat, dan tetap ikuti jadwal berikutnya. Namun bila dosis yang terlewat cukup banyak, segera bicarakan dengan dokter. Dokter dapat mengganti resep atau dosis obat sesuai kondisi pasien saat itu. Pasien HIV juga dapat mengonsumsi lebih dari 1 obat ARV dalam sehari. Karena itu, pasien perlu mengetahui efek samping yang timbul akibat konsumsi obat ini, di antaranya: Diare. Mual dan muntah. Mulut kering. Kerapuhan tulang. Kadar gula darah tinggi. Kadar kolesterol abnormal. Kerusakan jaringan otot (rhabdomyolysis). Penyakit jantung. Pusing. Sakit kepala. Sulit tidur. Tubuh terasa lelah. Untuk Info Segera Hubungi Kami HP/WA 081 329 878 999 Jika Anda memiliki HIV dan hamil, berkonsultasilah dengan dokter yang memiliki pengalaman tentang pengobatan HIV. Tanpa pengobatan, sekitar 25 dari 100 bayi yang lahir dari ibu dengan HIV juga terinfeksi. Namun, penggunaan obat-obatan HIV, operasi Caesar, tidak menyusui dapat mengurangi risiko penularan menjadi kurang dari 2 dari 100.

Consider how the principles of the law of accelerating returns apply to the epochs we discussed in the first chapter. The combination of amino acids into proteins and of nucleic acids into strings of RNA established the basic paradigm of biology. Strings of RNA (and later DNA) that self-replicated (Epoch Two) provided a digital method to record the results of evolutionary experiments. Later on, the evolution of a species that combined rational thought (Epoch Three) with an opposable appendage (the thumb) caused a fundamental paradigm shift from biology to technology (Epoch Four). The upcoming primary paradigm shift will be from biological thinking to a hybrid combining biological and nonbiological thinking (Epoch Five), which will include “biologically inspired” processes resulting from the reverse engineering of biological brains.

The ribosome did not contain the recipe for the protein; it was a tape reader. It could make any protein so long as it was fed the right tape of “messenger” RNA.

life’s business in a fundamentally different way—using a molecule other than DNA or RNA as genetic material, for example, or a different set of amino acids to build proteins.

that it was fantastically easy to target specific genes. All you had to do was select the desired twenty-letter DNA sequence to edit and then convert that sequence into a matching twenty-letter code of RNA. Once inside the cell, the RNA would couple with its DNA match using base pairing, and Cas9 would slice apart the DNA.

in the minds of many genetic engineers at the time—there was no difference between cells and computers. Computers use a software code of 1s and 0s, whereas biology uses a code of As, Cs, Ts, and Gs. Computers use compilers and storage registries; biology uses RNA (ribonucleic acid) and ribosomes. Computers use peripherals; biology uses proteins.

Some scientists also credit viruses with creating DNA in the first place (from RNA) billions of years ago, and they argue that viruses still invent most new genes today.

So, here it is,” I say. “This is a real-time view of the sample from the integrated electron microscope.” I step back, and give them a view of the screen. It shows a mass of spheres. They move randomly through the frame, occasionally bouncing off of one another. In among them, though, are other shapes. These are far fewer, larger, and more irregular. “See the balls?” I continue. “Those are what should have been produced. They’re temperature-sensitive cages, with serotonin inside. Those other things, though—they’re not supposed to be there. They look a bit like big viruses, but their mass is much higher than you’d expect from a biological. I’m guessing these are what the crypted code tacked onto the configuration file is producing.” “I thought we’d decided that Hagerstown couldn’t have been a virus,” Gary says. “I didn’t say these are viruses,” I say. “I said the protein coat we can see looks like what you’d see on a virus. That’s just the delivery mechanism. I’d be willing to bet that these things bind to cells like a virus, but what’s inside them is definitely not RNA.

Vaccination with a live-attenuated virus vaccine can be compared with the cross-species transmission of viruses that cause zoonotic infection. If the vaccine strain is an RNA virus, it can be expected that the vaccine inoculum will be made up of a population of genotypes representing the quasispecies which is created during replication and amplification of the virus in host cells. Furthermore, virus replication in the vaccine recipient creates genetic diversity, providing an opportunity for reversion of the attenuated phenotype. This is a real but rarely realized disadvantage of live-attenuated virus vaccines.

If the adaptor hypothesis were true (and it was), this meant that the role of DNA and RNA would be reduced to simply carrying genetic information: they had no direct structural role as templates; they were merely a medium

Man with all his noble qualities still bears in his bodily frame the indelible stamp of his lowly origin.

He settled on 16S rRNA, which is produced by a gene of the same name. It forms part of the essential protein-making machinery that is found in all organisms, and so provided the unit of universal comparison that Woese craved. By 1976, he had profiled 16S rRNA from around 30 different microbes. And in June of that year he started work on the species that would change his life – and biology as we know it.

Duality is particularly widespread within biological order, from the ‘base-pairs’ of (RNA and) DNA code, through the binary fission of bacterial propagation, the (binary) sexual difference of meiotic reproduction, to the bilateral symmetry of the typical vertebrate organism with consequent pairing of limbs (arms, legs), sense-organs (eyes, ears), lungs, brain-hemispheres, etc. ‘Dual-organization’ provides a basic model for primordial human kinship structure.

First in importance are the nucleic acids, DNA and RNA, which contain the genetic information, the software of life.

I held him to me, crying my heart out and saying things I had never said out loud before, like how much I loved him, how I hoped he was proud of me, and that I was as sorry as a person could be, so terribly sorry. I told him he didn’t deserve the life he was given.

Amongst the obvious, yes, you are shorter than me, but not all. Ever since I first saw you, you reminded me of a bird trying to break free from a cage. Yet, how can a Little Bird break free when she doesn't have the tools or means to do so? I knew from the start you were guarded. You could do whatever you wanted physically, and it wouldn’t affect you, but emotionally was an entirely different story. Birds are often frightened at the first approach of someone new or new experiences, even if that person was simply trying to help or aid in opening that cage door. It’s up to the bird to fly out of there and into freedom."-Hyder

I never force anyone to become a parasite because I am the parasite. I spent many years ashamed of what I was and still am. Yet you, my wild and free bird chose to let me of all people in. I knew instantly that no matter what, after that first night together, I knew I couldn’t and wouldn’t ever leave you. I would move heaven and earth if necessary. I would do it all again too. I regret hiding around and withholding the truth, but I don’t regret you, not for a second. You were the reason for all of it."-Hyder

CRISPR spacers are first transcribed into a long contiguous RNA, which is then sliced into discrete CRISPR RNAs corresponding to individual spacers. This RNA then forms a complex with Cas proteins that targets the corresponding

The mRNA approach could also provide a more reliable way to manufacture the vaccine in large quantities without relying on millions of chicken eggs.

Atoms, elements and molecules are three important knowledge in Physics, chemistry and Biology. mathematics comes where counting starts, when counting and measurement started, integers were required. Stephen hawking says integers were created by god and everything else is work of man. Man sees pattern in everything and they are searched and applied to other sciences for engineering, management and application problems. Physics, it is required understand the physical nature or meaning of why it happens, chemistry is for chemical nature, Biology is for that why it happened. Biology touch medicine, plants and animals. In medicine how these atoms, elements and molecules interplay with each other by bondage is being explained. Human emotions and responses are because of biochemistry, hormones i e anatomy and physiology. This physiology deals with each and every organs and their functions. When this atom in elements are disturbed whatever they made i e macromolecules DNA, RNA and Protein and other micro and macro nutrients and which affects the physiology of different organs on different scales and then diseases are born because of this imbalance/ disturb in homeostasis. There many technical words are there which are hard to explain in single para. But let me get into short, these atoms in elements and molecules made interplay because of ecological stimulus i e so called god. and when opposite sex meets it triggers various responses on body of each. It is also harmone and they are acting because of atoms inside elements and continuous generation or degenerations of cell cycle. There is a god cell called totipotent stem cell, less gods are pluripotent, multi potent and noni potent stem cells. So finally each and every organ system including brain cells are affected because of interplay of atoms inside elements and their bondages in making complex molecules, which are ruled by ecological stimulus i e god. So everything is basically biology and medicine even for animals, plants and microbes and other life forms. process differs in each living organisms. The biggest mystery is Brain and DNA. Brain has lots of unexplained phenomenon and even dreams are not completely understood by science that is where spiritualism/ soul touches. DNA is long molecule which has many applications as genetic engineering. genomics, personal medicine, DNA as tool for data storage, DNA in panspermia theory and many more. So everything happens to women and men and other sexes are because of Biology, Medicine and ecology. In ecology every organisms are inter connected and inter dependent. Now physics - it touch all technical aspects but it needs mathematics and statistics to lay foundation for why and how it happened and later chemistry, biology also included inside physics. Mathematics gave raise to computers and which is for fast calculation on any applications in any sciences. As physiological imbalances lead to diseases and disorders, genetic mutations, again old concept evolution was retaken to understand how new biology evolves. For evolution and disease mechanisms, epidemiology and statistics was required and statistics was as a data tool considered in all sciences now a days. Ultimate science is to break the atoms to see what is inside- CERN, but it creates lots of mysterious unanswerable questions. laws in physics were discovered and invented with mathematics to understand the universe from atoms. Theory of everything is a long search and have no answers. While searching inside atoms, so many hypothesis like worm holes and time travel born but not yet invented as far as my knowledge. atom is universe, and humans are universe they have everything that universe has. ecology is god that affects humans and climate. In business these computerized AI applications are trying to figure out human emotions by their mechanism of writing, reading, texting, posting on social media and bla bla. Arts is trying to figure out human emotions in art way.

The actual mechanics of cell division, according to Dick McIntosh at the University of Denver, require significantly more instructions than it takes to build a moon rocket or supercomputer. First of all, the cell needs to duplicate all of its molecules, that is DNA, RNA, proteins, lipids, etc. At the organelle level, several hundred mitochondria, large areas of ER, new Golgi bodies, cytoskeletal structures, and ribosomes by the million all need to be duplicated so that the daughter cells have enough resources to grow and, in turn, divide themselves. All these processes make up the ‘cell cycle’. Some cells will divide on a daily basis, others live for decades without dividing. The cell cycle is divided into phases, starting with interphase, the period between cell divisions (about 23 hours), and mitosis (M phase), the actual process of separating the original into two daughter cells (about 1 hour). Interphase is further split into three distinct periods: gap 1 (G1, 4–6 hours), a synthesis phase (S, 12 hours), and gap 2 (G2, 4–6 hours). Generally, cells continue to grow throughout interphase, but DNA replication is restricted to the S phase. At the end of G1 there is a checkpoint. If nutrient and energy levels are insufficient for DNA synthesis, the cell is diverted into a phase called G0. In 2001 Tim Hunt, Paul Nurse, and Leeland Hartwell received the Nobel Prize for their work in discovering how the cell cycle is controlled. Tim Hunt found a set of proteins called cyclins, which accumulate during specific stages of the cell cycle. Once the right level is reached, the cell is ‘allowed’ to progress to the next stage and the cyclins are destroyed. Cyclins then start to build up again, keeping a score of the progress at each point of the cycle, and only allowing progression to the next stage if the correct cyclin level has been reached.

Although the nucleus might have been recognized by Antonie van Leeuwenhoek in the late 17th century, it was not until 1831 that it was reported as a specific structure in orchid epidermal cells by a Scottish botanist, Robert Brown (better known for recognizing ‘Brownian movement’ of pollen grains in water). In 1879, Walther Flemming observed that the nucleus broke down into small fragments at cell division, followed by re-formation of the fragments called chromosomes to make new nuclei in the daughter cells. It was not until 1902 that Walter Sutton and Theodor Boveri independently linked chromosomes directly to mammalian inheritance. Thomas Morgan’s work with fruit flies (Drosophila) at the start of the 20th century showed specific characters positioned along the length of the chromosomes, followed by the realization by Oswald Avery in 1944 that the genetic material was DNA. Some nine years later, James Watson and Francis Crick showed the structure of DNA to be a double helix, for which they shared the Nobel Prize in 1962 with Maurice Wilkins, whose laboratory had provided the evidence that led to the discovery. Rosalind Franklin, whose X-ray diffraction images of DNA from the Wilkins lab had been the key to DNA structure, died of cancer aged 37 in 1958, and Nobel Prizes are not awarded posthumously. Watson and Crick published the classic double helix model in 1953. The final piece in the jigsaw of DNA structure was produced by Watson with the realization that the pairing of the nucleotide bases, adenine with thymine and guanine with cytosine, not only provided the rungs holding the twisting ladder of DNA together, but also provided a code for accurate replication and a template for protein assembly. Crick continued to study and elucidate the base pairing required for coding proteins, and this led to the fundamental ‘dogma’ that ‘DNA makes RNA and RNA makes protein’. The discovery of DNA structure marked an enormous advance in biology, probably the most significant since Darwin’s publication of On the Origin of Species .