Rna Quotes

We've searched our database for all the quotes and captions related to Rna. Here they are! All 100 of them:

Mai tu sarie amn, tu hae'si, tu kii'rna dae. There is nothing as painful, or as simple, as doing what is right.
Amie Kaufman
I haven't learned How or why Universe contrived to implode And intellectually code The myriadly unique Chromosomically orchestrated DNA-RNA, Quadripartite moleculed, Binary paired, Helically extended And unzippingly dichotomied Regenerative symphonic jazz, as A one and two, Three and four Me---You, Thee---They And more Thine and mine, Sweet citizen, THYMINE-CYTOSINE GUANINE-ADENINE
R. Buckminster Fuller (And It Came To Pass — Not To Stay)
CRAB—Conservable RNA Augmented Body—the faithful servant for a citizen, as the advertisements from the New World Government say. This parasitic bio-computer, installed in his left wrist, bears his identity.
Misba (The High Auction (Wisdom Revolution, #1))
At one time, we thought that the way life came together was almost completely random, only needing an energy gradient to get going. But as we’ve moved into the information age, we’ve come to realize that life is more about information than energy. Fire has most of the characteristics of life. It eats, it grows, it reproduces. But fire retains no information. It doesn’t learn; it doesn’t adapt. The five millionth fire started by lightning will behave just like the first. But the five hundredth bacterial division will not be like the first one, especially if there is environmental pressure. That’s DNA. And RNA. That’s life. …
Dennis E. Taylor (We Are Legion (We Are Bob) (Bobiverse, #1))
I created the Katie Fforde Bursary because I was a "nearly there" writer for a long time. I found it a bit of a struggle to pay my annual subscription to the Romantic Novelists' Association so when I finally became published, I wanted to give something back. That's the bursary, a year's subscription and a place at the conference. It does seem to give people a valuable boost to their confidence. People can find out more about the Romantic Novelists' Association at www.rna-uk.org
Katie Fforde
This overall flow of genetic information—from DNA to RNA to protein—is known as the central dogma of molecular biology, and it is the language used to communicate and express life.
Jennifer A. Doudna (A Crack In Creation: A Nobel Prize Winner's Insight into the Future of Genetic Engineering)
His thought about the bird halts as the CRAB in his wrist glows. CRAB—Conservable RNA Augmented Body, the faithful servant for a citizen, as the advertisements from the World Government say. This parasitic bio-computer, installed in his left wrist, bears his identity. A hologram projects on it when he fists that hand near his chest. A text message visible in his inbox: You’re missing the Independence Day Speech, auto-signed with Ren. Yuan ignores it. The next text plays in his brain when he is not looking at the CRAB: Come on! The war-hero can’t miss the speech in Alphatech when the war hero himself is its owner! Ren. Yuan doesn’t reply to Ren Agnello, the CEO of Alphatech—the world’s leading transport and robotics industry, of which the Monk is the founder. Well, one of the two founders.
Misba (The High Auction (Wisdom Revolution, #1))
Matter and energy are equivalent, according to the equation E=mc2, where E stand for energy, m for mass and c for the speed of light,' 'Merapa explained. 'Matter can't be transported at the speed of light but energy can. Therefore, during a time shift transformation, matter is converted to energy then condenses back. In other words all the molecules in your body have been changed from matter to energy then back again.' 'Wow. It's a wonder it's not fatal,' Dirck said. 'Sometimes it is. If any transcription errors occur between the DNA and RNA in your vital organs you're all but dead.
Marcha A. Fox (Beyond the Hidden Sky (Star Trails Tetralogy, #1))
Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).
Nick Land (Fanged Noumena: Collected Writings 1987 - 2007)
It is unclear how much longer people will write on dried and flattened wood. Trees do so much for humans and for our planet that it hardly seems fair to ask them to carry our thoughts as well. From "Life from an RNA World: The Ancestor Within.
Michael Yarus
A DNA sequence for the genome of bacteriophage ΦX174 of approximately 5,375 nucleotides has been determined using the rapid and simple 'plus and minus' method. The sequence identifies many of the features responsible for the production of the proteins of the nine known genes of the organism, including initiation and termination sites for the proteins and RNAs. Two pairs of genes are coded by the same region of DNA using different reading frames.
Frederick Sanger
how a piece of RNA could pair up with its phage DNA counterpart and cause that DNA to be destroyed.
Jennifer A. Doudna (A Crack In Creation: A Nobel Prize Winner's Insight into the Future of Genetic Engineering)
What does it mean to live in a world where you have the power to end species by the thousands, but you can also be brought to your knees, or to your end, by a single strand of RNA?
John Green (The Anthropocene Reviewed: Essays on a Human-Centered Planet)
RNA, on the other hand, actually goes out and does real work. Instead of just sitting at home curating information, it makes real products, such as proteins.
Walter Isaacson (The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race)
Thomas Cech (pronounced “check”) of the University of Colorado in Boulder, who was using X-ray crystallography in order to explore each nook and cranny of the structure of RNA.
Walter Isaacson (The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race)
Billions of dollars in profits that have resulted for some of those pursuing mRNA research will likely bring more talent, financing, and improvements in the field.
Gregory Zuckerman (A Shot to Save the World: The Inside Story of the Life-or-Death Race for a COVID-19 Vaccine)
The circular flow of biological information - Genes encode RNAs to build Proteins to form/regulate Organisms that sense Environments that influence Proteins, RNA that regulate Genes.
Siddharta Mukherjee
Caffeine not only dehydrates the body, but also leaches calcium and magnesium, and is an antagonist to the neurotransmitter, adenosine. Adenosine is needed for RNA synthesis (function).
Barbara & Tania O'Neill (Self Heal By Design - By Barbara O'Neill: The Role Of Micro-Organisms For Health)
some forms of RNA could likewise be enzymes. Specifically, they found that some RNA molecules can split themselves by sparking a chemical reaction. They dubbed these catalytic RNAs “ribozymes,
Walter Isaacson (The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race)
RNA (ribonucleic acid) is a molecule in living cells that is similar to DNA (deoxyribonucleic acid), but it has one more oxygen atom in its sugar-phosphate backbone and a difference in one of its four bases.
Walter Isaacson (The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race)
Doudna’s mission when she arrived at the University of Colorado as a postdoc was to map the intron that Cech had discovered could be a self-splicing piece of RNA, showing all of its atoms, bonds, and shapes.
Walter Isaacson (The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race)
But she became more interested in DNA’s less-celebrated sibling, RNA. It’s the molecule that actually does the work in a cell by copying some of the instructions coded by the DNA and using them to build proteins.
Walter Isaacson (The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race)
Apart from a few viruses, all life on Earth now relies on DNA to hold the information that it needs to reproduce. But the most likely players in the first games of life were molecules of the related genetic material RNA, which is more flexible than DNA because it can both carry information down the generations and also catalyze—speed up—chemical reactions, a very handy feat. And RNA still carries out all kinds of critical roles in organisms that are described by DNA, including human beings.
M.A. Nowak (SuperCooperators: Altruism, Evolution, and Why We Need Each Other to Succeed)
A small segment of DNA that encodes a gene is transcribed into a snippet of RNA, which then travels to the manufacturing region of the cell. There this “messenger RNA” facilitates the assembly of the proper sequence of amino acids to make a specified protein.
Walter Isaacson (The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race)
What does it mean to live in a world where you have the power to end species by the thousands, but you can also be brought to your knees, or to your end, by a single strand of RNA?[...]the only conclusion I can draw is a simple one: We are so small, and so frail, so gloriously and terrifyingly temporary.
John Green (The Anthropocene Reviewed: Essays on a Human-Centered Planet)
It turns out that tracrRNA performs two important tasks. First, it facilitates the making of the crRNA, the sequence that carries the memory of a virus that previously attacked the bacteria. Then it serves as a handle to latch on to the invading virus so that the crRNA can target the right spot for the Cas9 enzyme to chop.
Walter Isaacson (The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race)
An arcane microbial defense, devised by microbes, discovered by yogurt engineers, and reprogrammed by RNA biologists, has created a trapdoor to the transformative technology that geneticists had sought so longingly for decades: a method to achieve directed, efficient, and sequence-specific modification of the human genome.
Siddhartha Mukherjee (The Gene: An Intimate History)
It also showed that the only real block to bi-maternal reproduction is the DNA methylation pattern at key genes. It disproved a previous hypothesis that sperm were required because the sperm themselves carried certain necessary accessory factors such as particular proteins or RNA molecules required to kick-start development properly.16
Nessa Carey (Junk DNA: A Journey Through the Dark Matter of the Genome)
When the genetic code was solved, in the early 1960s, it turned out to be full of redundancy. Much of the mapping from nucleotides to amino acids seemed arbitrary—not as neatly patterned as any of Gamow’s proposals. Some amino acids correspond to just one codon, others to two, four, or six. Particles called ribosomes ratchet along the RNA strand and translate it, three bases at a time. Some codons are redundant; some actually serve as start signals and stop signals. The redundancy serves exactly the purpose that an information theorist would expect. It provides tolerance for errors. Noise affects biological messages like any other. Errors in DNA—misprints—are mutations.
James Gleick (The Information: A History, a Theory, a Flood)
It was a biochemical Jackson Pollock: a field of strings, tangles, loops.
Carl Zimmer (Life's Edge: The Search for What It Means to Be Alive)
Influenza is caused by three types of viruses, of which the most worrisome and widespread is influenza A. Viruses of that type all share certain genetic traits: a single-stranded RNA genome, which is partitioned into eight segments, which serve as templates for eleven different proteins. In other words, they have eight discrete stretches of RNA coding, linked together like eight railroad cars, with eleven different deliverable cargoes. The eleven deliverables are the molecules that comprise the structure and functional machinery of the virus. They are what the genes make. Two of those molecules become spiky protuberances from the outer surface of the viral envelope: hemagglutinin and neuraminidase. Those two, recognizable by an immune system, and crucial for penetrating and exiting cells of a host, give the various subtypes of influenza A their definitive labels: H5N1, H1N1, and so on. The term “H5N1” indicates a virus featuring subtype 5 of the hemagglutinin protein combined with subtype 1 of the neuraminidase protein. Sixteen different kinds of hemagglutinin, plus nine kinds of neuraminidase, have been detected in the natural world. Hemagglutinin is the key that unlocks a cell membrane so that the virus can get in, and neuraminidase is the key for getting back out. Okay so far? Having absorbed this simple paragraph, you understand more about influenza than 99.9 percent of the people on Earth. Pat yourself on the back and get a flu shot in November. At
David Quammen (Spillover: Animal Infections and the Next Human Pandemic)
medicine hadn’t really changed much since the days of leeches and poultices; nowadays they whirred one in centrifuges, realigned the body’s magnetic field, bombarded the victim with sonic waves, tapped into the cells to interrogate the RNA, and then admitted their ignorance without actually coming out and saying so. The only thing that had changed was that the bills were bigger.
Dan Simmons (Hyperion (Hyperion Cantos, #1))
RNA interference operates by deploying an enzyme known as “Dicer.” Dicer snips a long piece of RNA into short fragments. These little fragments can then embark on a search-and-destroy mission: they seek out a messenger RNA molecule that has matching letters, then they use a scissors-like enzyme to chop it up. The genetic information carried by that messenger RNA is thus silenced.
Walter Isaacson (The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race)
In fact, the CDC would later implicitly acknowledge the system’s value when it admitted in June that the mRNA vaccines could cause myocarditis—a potentially serious heart problem—in young men. Side effect reports from VAERS formed the core of the agency’s analysis.37 Yet even after that finding, the stories dismissing the value of the VAERS reports went on.38 I am not an “anti-vaxxer.
Alex Berenson (Pandemia: How Coronavirus Hysteria Took Over Our Government, Rights, and Lives)
Doudna wrote in a scholarly publication back in 2013, researchers hoped to find ways to use RNA interference to protect humans from infections.6 Two papers published in Science that year gave strong evidence that it might work. The hope then was that drugs based on RNA interference might someday be a good option for treating severe viral infections, including those from new coronaviruses
Walter Isaacson (The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race)
Let me put a little makeup on,” I said to him. “You don’t need it, come.” He held out his hand. “At least let me make sure my hair is tidy,” I said in a slightly irritated tone. “You’re perfect, and it’s already seven.
R.N.A. (Parasite (Para-Series #1))
Nature isn’t benign,” Lederberg said at the meeting’s opening. “The bottom lines: the units of natural selection—DNA, sometimes RNA elements—are by no means neatly packaged in discrete organisms. They all share the entire biosphere. The survival of the human species is not a preordained evolutionary program. Abundant sources of genetic variation exist for viruses to learn new tricks, not necessarily confined to what happens routinely, or even frequently.
Laurie Garrett (The Coming Plague: Newly Emerging Diseases in a World Out of Balance)
Through much resistance on my part, you made it easy, and it was so different from basic relationships or familial love. I didn’t know what it was about you that made things so peculiar. You talk about your scent fetish, but as it turned out, I was also addicted to yours. It wasn’t a game for me, and I felt it much deeper than I can probably even describe in words—the combining of souls. If you weren’t around, I found myself missing you; I found myself needing you. My body, my mind, and my spirit need you. I am the world’s biggest fool, the biggest pain in the ass, but I’m stupidly, unapologetically, and whole-heartedly in love with you. I’ve waited so long to tell you that."-Tara
R.N.A. (Parasite (Para-Series #1))
Kısa bir süre sonra bakteri savunma sisteminin en az iki kritik bileşen içerdiği anlaşıldı. Bunlardan birincisi ''arayıcı'' idi - virüsün DNA'sıyla örtüşerek tanıyan bakteri RNA'sı. Bu tanıma ilkesi de hayret vericiydi: ''Arayıcı'' RNA, virüs DNA'sının ayna görüntüsüydü - yin ve yang gibi. Böylece istilacı virüsün DNA'sını fark edebiliyordu. Düşmanın resmini sürekli cebinde taşır gibi veya bakteri örneğinde, düşmanın resminin negatifini genomunda taşır gibi.
Siddhartha Mukherjee (The Gene: An Intimate History)
In the late 1970s, scientists working on gene-silencing discovered that the attachment of a small molecule-a methyl group-to DNA was correlated with a gene's turning off. These methyl tags decorated the strands of DNA, like charms on a necklace, and they were recognized as shutdown signals. The production of RNA ceased and the expression of the gene was silenced. If a chromosome was heavily decorated by methyl tags, then perhaps the whole chromosome could be silenced.
Siddhartha Mukherjee (The Gene: An Intimate History)
Dr. Mackay said that this idea is actually somewhat reasonable, from a purely biological point of view. He said that rhinoviruses—and other RNA respiratory viruses—are completely eliminated from the body by the immune system; they do not linger after infection. Furthermore, we don’t seem to pass any rhinoviruses back and forth with animals, which means there are no other species that can serve as reservoirs of our colds. If rhinoviruses don’t have enough humans to move between, they die out.
Randall Munroe (What If?: Serious Scientific Answers to Absurd Hypothetical Questions)
It’s a combination of the pseudouridine incorporating into the RNA and the toxicity of the lipids and the toxicity of the complexes as a whole, which is separate from the toxicity of the spike. So, we’ve really got three categories of toxicities. We got the payload toxicity—that’s your spike issues. We got the cationic lipid and associated nanoplex toxicity. And we have the toxicity of the pseudouridine incorporating molecule, which is not really a natural RNA; it’s something else altogether.
Steve Deace (Rise of the Fourth Reich: Confronting COVID Fascism with a New Nuremberg Trial, So This Never Happens Again)
Years ago, however, with the development of lipid nanoparticles (LNPs), molecules were found that could act as brain-penetrating packaging material; that is, they could cross the blood-brain barrier. Their original use was to deliver chemotherapeutic drugs to the brain for the treatment of brain tumors (see sidebar Brain Toxic Packaging).37 It was no secret that LNPs could also be used to deliver genetic material in the form of DNA or mRNA to the brain or brain cells to become biologically active.
Michael Nehls (The Indoctrinated Brain: How to Successfully Fend Off the Global Attack on Your Mental Freedom)
The word epigenetics literally means “above the gene.” It refers to the control of genes not from within the DNA itself but from messages coming from outside the cell—in other words, from the environment. These signals cause a methyl group (one carbon atom attached to three hydrogen atoms) to attach to a specific spot on a gene, and this process (called DNA methylation) is one of the main processes that turns the gene off or on. (Two other processes, covalent histone modification and noncoding RNA, also turn genes on and off,
Joe Dispenza (You Are the Placebo: Making Your Mind Matter)
The CRISPR-based tests developed by Mammoth and Sherlock are cheaper and faster than conventional PCR tests. They also have an advantage over antigen tests, such as the one developed by Abbott Labs that was approved in August of the plague year. The CRISPR-based tests can detect the presence of the RNA of a virus as soon as a person has been infected. But the antigen tests, which detect the presence of proteins that exist on the surface of the virus, are most accurate only after a patient has become highly infectious to others.
Walter Isaacson (The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race)
Viruses are just single strands of RNA or DNA lying around. They can’t replicate until and unless they find a cell to hijack. So they aren’t alive, but they also aren’t not alive. Once a virus invades a cell, it does what life does—it uses energy to make more of itself. Viruses remind me that life is more of a continuum than a duality. Sure, viruses aren’t living, because they need host cells to replicate. But then again, many bacteria also can’t survive without hosts, and stranger still, many hosts can’t survive without bacteria.
John Green (The Anthropocene Reviewed: Essays on a Human-Centered Planet)
Genetik kod basittir: DNA'dan RNA inşa edilir, RNA'dan da protein inşa edilir. DNA'daki her baz üçlüsü, proteinde bir aminoasidi belirler. Oysa genomik kod karmaşıktır: Genin üzerinde, genin ne zaman ve nerede ifade edileceği ile ilgili bilgileri barındıran DNA parçaları vardır: Genlerin genom üzerindeki yerlerinin neye göre belirlenmiş olduğunu da bilmiyoruz. Genler arasındaki DNA bölgelerinin gen fizyolojisini nasıl düzenlediğini ve koordine ettiğini de bilmiyoruz. Dağların ötesinde dağların olması gibi, kodların ötesinde de kodlar vardır.
Siddhartha Mukherjee (The Gene: An Intimate History)
RNA viruses are limited to small genomes because their mutation rates are so high, and their mutation rates are so high because they’re limited to small genomes. In fact, there’s a fancy name for that bind: Eigen’s paradox. Manfred Eigen is a German chemist, a Nobel winner, who has studied the chemical reactions that yield self-organization of longer molecules, a process that might lead to life. His paradox describes a size limit for such self-replicating molecules, beyond which their mutation rate gives them too many errors and they cease to replicate. They die out. RNA
David Quammen (Spillover: Animal Infections and the Next Human Pandemic)
دل لالچی ہے۔ دل فتنہ پسند ہے۔ دل بہانے باز ہے۔ آخر انسان کا دل غلط کام کرنے کے لیے اتنا للچاتا کیوں ہے؟ بیماری میں بد پرہیزی کھانا کھانے کے لیے۔ انٹرنیٹ پر خوامخواہ وقت ضائع کرنے کے لیے۔ بے پردگی کی حدود میں داخل نئے فیشن کے لیے۔ غیر اسلامی کپڑے اور عادات و اطوار اپنانے کے لئے۔ ایسا کوئی دن نہیں جاتا جب کسی سماجی، معاشرتی، مذہبی اصول کو توڑنے کا خیال دل میں نہ آئے۔دل کا یہ بہلاوا کہ یہ تو ایک چھوٹی سی بے ضرر سی بات ہے۔ اسلام کے خلاف نہیں۔ کوئی یہ نہیں سمجھتا کہ چھوٹی چھوٹی غلطیاں کرتے کرتے ، بڑے گناہ بھی چھوٹے لگنے لگتے ہیں۔ شبانہ مختار کے ناول 'بچھڑنا نصیب تھا' سے اقتباس
Shabana Mukhtar (BichhaRna Naseeb Thha بچھڑنا نصیب تھا)
Primitive “bondmaker” molecules, early precursors of the RNA system, which bind nucleotides together, came into existence way before the first cells. So, too, did bondmaker molecules that developed the ability to join nucleotides together following a template—“copymakers.” These bondmakers and copymakers came into existence through random molecular re-sorting. It was the existence of copymaker molecules that set the process of evolution into motion. Natural selection chiseled living things into existence, but the requisite molecules for evolution—the bondmakers and copymakers—existed before life itself.
Michael S. Gazzaniga (The Consciousness Instinct: Unraveling the Mystery of How the Brain Makes the Mind)
of now, the main difference has been found in the HAR1 (human accelerated region 1), a segment of a recently discovered RNA gene. The RNA that is expressed in early development (HAR1F) is specific to the reelin-producing Cajal-Retzius cells in the brain. HAR1F comes to expression together with reelin in the seventeenth to nineteenth weeks of fetal development, a crucial stage in the formation of the six-layered cerebral cortex. The mutations in this human gene are probably over a million years old and could have played a crucial role in the emergence of modern humankind. Throughout our evolution, an enormous
D.F. Swaab (We Are Our Brains: A Neurobiography of the Brain, from the Womb to Alzheimer's)
What is that 95 percent? Some is junk—remnants of pseudogenes inactivated by evolution.fn4,3 But buried in that are the keys to the kingdom, the instruction manual for when to transcribe particular genes, the on/off switches for gene transcription. A gene doesn’t “decide” when to be photocopied into RNA, to generate its protein. Instead, before the start of the stretch of DNA coding for that gene is a short stretch called a promoterfn5—the “on” switch. What turns the promoter switch on? Something called a transcription factor (TF) binds to the promoter. This causes the recruitment of enzymes that transcribe the gene into RNA. Meanwhile, other transcription factors deactivate genes.
Robert M. Sapolsky (Behave: The Biology of Humans at Our Best and Worst)
Why has DNA had a monopoly on molecular symbolism over the past few hundreds of millions of years? In its physical manifestation, DNA is extremely structurally stable, unlike RNA. This has helped DNA remain the symbolic structure of choice throughout evolution. However, while the DNA in our cells and the cells of other living organisms is now very stable, the structure of DNA did not start out that way at the very origins of life. Random shuffling and re-sorting of molecules, through the irreversible and probabilistic process of natural selection, generated molecules resembling nucleotide bases. Through subsequent shuffling, successful DNA components and sequences survived and replicated.
Michael S. Gazzaniga (The Consciousness Instinct: Unraveling the Mystery of How the Brain Makes the Mind)
At one time, we thought that the way life came together was almost completely random, only needing an energy gradient to get going. But as we’ve moved into the information age, we’ve come to realize that life is more about information than energy. Fire has most of the characteristics of life. It eats, it grows, it reproduces. But fire retains no information. It doesn’t learn; it doesn’t adapt. The five millionth fire started by lightning will behave just like the first. But the five hundredth bacterial division will not be like the first one, especially if there is environmental pressure. That’s DNA. And RNA. That’s life. … Dr. Steven Carlisle, from the Convention panel Exploring the Galaxy
Dennis E. Taylor (We Are Legion (We Are Bob) (Bobiverse, #1))
Shadow is the blue patch where the light doesn’t hit. It is mystery itself, and mystery is the ancients’ ultima Thule, the modern explorer’s Point of Relative Inaccessibility, that boreal point most distant from all known lands. There the twin oceans of beauty and horror meet. The great glaciers are calving. Ice that sifted to earth as snow in the time of Christ shears from the pack with a roar and crumbles to water. It could be that our instruments have not looked deeply enough. The RNA deep in the mantis’s jaw is a beautiful ribbon. Did the crawling Polyphemus moth have in its watery heart one cell, and in that cell one special molecule, and that molecule one hydrogen atom, and round that atom’s nucleus one wild, distant electron that split showed a forest, swaying?
Annie Dillard (Pilgrim at Tinker Creek)
Here I should issue a caveat. In origins-of-life research (and probably in most other disciplines as well), scientists gravitate to models that highlight their personal scientific specialty. Organic chemist Stanley Miller and his cohorts saw life’s origins as essentially a problem in organic chemistry. Geochemists, by contrast, have tended to focus on more intricate origins scenarios involving such variables as temperature and pressure and chemically complex rocks. Experts in membrane-forming lipid molecules promote the “lipid world,” while molecular biologists who study DNA and RNA view the “RNA world” as the model to beat. Specialists who study viruses, or metabolism, or clays, or the deep biosphere have their idiosyncratic prejudices as well. We all do it; we all focus
Robert M. Hazen (The Story of Earth: The First 4.5 Billion Years, from Stardust to Living Planet)
Genes, oddly, compromise only a minuscule fraction of it. An enormous proportion-a bewildering 98 percent-is not dedicated to genes per se, but to enormous stretches of DNA that are interspersed between genes (intergenic DNA) or within genes (introns). These long stretches encode no RNA, and no protein: they exist in the genome either because they regulate gene expression, or for reasons that we do not yet understand, or because of no reason whatsoever (i.e., they are "junk" DNA). If the genome were a line stretching across the Atlantic Ocean between North America and Europe, genes would be occasional specks of land strewn across long, dark tracts of water. Laid end to end, these specks would be no longer than the largest Galapagos island or a train line across the city of Tokyo,
Siddhartha Mukherjee (The Gene: An Intimate History)
During replication, those nucleotides are read and translated into linear strings of amino acids (which make up enzymes and proteins) by a rule-governed process. The set of rules is called the genetic code. The DNA contains the sequence, but the code is implemented by RNA molecules. Certain DNA sequences, called codons, which are made up of three nucleotides, symbolize certain amino acid sequences. There is no ambiguity, but there is also not just one codon for each amino acid. For example, six different codons symbolize arginine, but only one codon symbolizes tryptophan. But the components of the DNA sequence (the symbol) do not resemble the components of the amino acid sequence (its meaning), just as the words that symbolize the components of a recipe do not resemble the components themselves.
Michael S. Gazzaniga (The Consciousness Instinct: Unraveling the Mystery of How the Brain Makes the Mind)
The third cardinal feature of gene regulation, Monod and Jacob discovered, was that every gene had specific regulatory DNA sequences appended to it that acted like recognition tags. Once a sugar sensing-protein had detected sugar in the environment, it would recognize one such tag and turn the target genes on or off. That was a gene's signal to make more RNA messages and thereby generate the relevant enzyme to digest the sugar. A gene, in short, possessed not just information to encode a protein, but also information about when and where to make that protein. All that data was encrypted in DNA, typically appended to the front of every gene (although regulatory sequences) an also be appended to the ends and middle of genes). The combination of regulatory sequences and the protein-encoding sequence defined a gene.
Siddhartha Mukherjee (The Gene: An Intimate History)
The DNA-RNA apparatus isn't the whole secret of life, but a sort of computer program by which the real secret, the control system, ex-presses its pattern in terms of living cells.This pattern is part of what many people mean by the soul, which somany philosophies have tried to explicate. However, most of the pro-posed answers haven't been connected with the physical world of biology in a way that offered a toehold for experiment. Like many attempts, the latest major scientific guess, the morphogenetic field proposed by Paul Weiss in 1939, was just a restatement of the problem, though a useful one. Weiss conjectured that development was guided by some sort of field projected from the fertilized egg. As the dividing cell mass became an embryo and then an adult, the field changed its shape and somehow led the cells onward.
Robert O. Becker (The Body Electric: Electromagnetism and the Foundation of Life)
The DNA is made up of two opposite spirals, positive and negative, which can easily be considered isomorphic to I Ching's yin () and yang (), or Leibniz's 0 and 1, or Joyce's and . These are bonded by four amino acids—adenine, guanine, cytosine and thymine, which are usually abbreviated A, G, C, T. If one dares to consider these isomorphic with active yang (), passive yang (), active yin () and passive yin (), or Leibniz's 01,11,10 and 00, or Joyce's and , then the parallel becomes staggering. In forming RNA messages—the genetic code—the T (thymine) drops out to be replaced by U (uracil) but we still have four elements—A, G, C, U—and if we permutate them by the now-familiar rule, making all possible combinations of three out of these basic four "letters," we get again 43 or 64 "words," which are the 64 elements of the genetic language.
Robert Anton Wilson (Coincidance: A Head Test)
To make things even more challenging, cells must also be able to make all of their component molecular machines using only the resources that are available in the local environment. Think of the magnitude of this accomplishment. Many bacteria are able to build all of their own molecules from the a few simple raw materials like carbon dioxide, oxygen, and ammonia. A single bacterial cell knows how to build several thousand types of proteins, including motors, girders, toxins, catalysts, and construction machinery. This cell also builds hundreds of RNA molecules with different orderings of nucleotides, as well as a diverse collection of lipids, sugar polymers, and a bewildering collection of exotic small molecules. All of these different molecules must be created from scratch, using only the molecules that the cell eats, drinks, and breathes.
David S. Goodsell (The Machinery of Life)
I guess you’ll have to keep visiting me then,” I said playfully. He nuzzled his face into my neck, and I giggled quietly. “Do you mean that?” He asked, searching my face for answers shortly after. “If I didn’t, would I have even offered? Also, if I said no, would that really stop you?” I smirked, and he smiled playfully. “True, but if I knew you really meant it, I would leave you alone even if it went against all my instincts.
R.N.A. (Parasite (Para-Series #1))
How does the body push the comparatively tiny genome so far? Many researchers want to put the weight on learning and experience, apparently believing that the contribution of the genes is relatively unimportant. But though the ability to learn is clearly one of the genome's most important products, such views overemphasize learning and significantly underestimate the extent to which the genome can in fact guide the construction of enormous complexity. If the tools of biological self-assembly are powerful enough to build the intricacies of the circulatory system or the eye without requiring lessons from the outside world, they are also powerful enough to build the initial complexity of the nervous system without relying on external lessons. The discrepancy melts away as we appreciate the true power of the genome. We could start by considering the fact that the currently accepted figure of 30,000 could well prove to be too low. Thirty thousand (or thereabouts) is, at press time, the best estimate for how many protein-coding genes are in the human genome. But not all genes code for proteins; some, not counted in the 30,000 estimate, code for small pieces of RNA that are not converted into proteins (called microRNA), of "pseudogenes," stretches of DNA, apparently relics of evolution, that do not properly encode proteins. Neither entity is fully understood, but recent reports (from 2002 and 2003) suggest that both may play some role in the all-important process of regulating the IFS that control whether or not genes are expressed. Since the "gene-finding" programs that search the human genome sequence for genes are not attuned to such things-we don't yet know how to identify them reliably-it is quite possible that the genome contains more buried treasure.
Gary F. Marcus (The Birth of the Mind: How a Tiny Number of Genes Creates The Complexities of Human Thought)
A virus particle is a very small capsule made of proteins locked together in a mathematical pattern. The pattern of the interlocking proteins in a virus is far more complicated than a snowflake. The protein capsule is sometimes wrapped in an oily membrane. Inside the capsule there is a small amount of DNA or RNA, the molecules that contain the genetic code of the virus. The genetic code is the virus’s operating system, or wetware, the complete set of instructions for the virus to make copies of itself. Unlike a snowflake or any other kind of crystal, a virus is able to re-create its form. It would be as if a single snowflake started copying itself as it falls, and those copies of the snowflake copy themselves, creating ever-growing numbers of identical copies of the first snowflake, until the air is filled with falling snow, and each flake is a perfect replica of the first flake.
Richard Preston (Crisis in the Red Zone: The Story of the Deadliest Ebola Outbreak in History, and of the Outbreaks to Come)
Recently scientists have found that cephalopods (the family that contains the octopus) can recode their RNA. RNA molecules have the privilege of establishing codes with DNA (in the part of the RNA that recognizes the three-nucleotide DNA codon sequence) and also with proteins (in the separate part of the RNA that recognizes the amino acid). Recoding the RNA means that new proteins can be constructed while the DNA sequence of symbols stays the same. The collective result is the destruction of the one-to-one gene-to-protein correspondence. Recoding allows a single octopus gene to produce many different types of proteins from the same DNA sequence.18 This is a big deal. It is evidence against the three concepts in biology that dismiss semiotic systems in living organisms. The system can change its code. The system has an internal codemaker that can produce biological innovations—new proteins—but not via natural selection. It illustrates the arbitrariness of the connection of a symbol with its meaning in a living system. If symbols within living systems
Michael S. Gazzaniga (The Consciousness Instinct: Unraveling the Mystery of How the Brain Makes the Mind)
Superimposed on the hierarchical framework of defined components of a cell there is another layer. This second layer is highly flexible and can take on an almost infinite variety of forms, like soft and responsive flesh on a bony skeleton. The deep question is whether this higher layer in the construction of cells is itself organized. Are there hierarchies, or at least rules, in the protein-modifying, RNA splicing, gene-regulating processes of a cell? If so, then we have a chance of understanding them. If not, we will never know exactly what a cell will do next. If the detailed chemistry of the cell is simply the outcome of a historical ragbag of ad hoc interactions, then it will be no more predictable than the weather. I do not have an answer to this question. But two features of cells might be relevant. One is a sense of time, or causation - knowledge of the way that things in the real world follow in a certain sequence. The other is integrity, which enables a cell to distinguish between what belongs to itself and what belongs to the outside world.
Dennis Bray (Wetware: A Computer in Every Living Cell)
The bacterial defense system was soon found to involve at least two critical components. The first piece was the "seeker"-an RNA encoded in the bacterial genome that matched and recognized the DNA of the viruses. The principle for the recognition, yet again, was binding: the RNA "seeker" was able to find and recognize the DNA of an invading virus because it was a mirror image of that DNA-the yin to its yang. It was like carrying a permanent image of your enemy in your pocket-or, in the bacteria's case, an inverted photograph, etched indelibly into its genome. The second element of the defense system was the "hitman." Once the viral DNA had been recognized and matched as foreign (by its reverse-image), a bacterial protein named Cas9 was deployed to deliver the lethal gash to the viral gene. The "seeker" and the "hitman" worked in concert: the Cas9 protein delivered its cuts to the genome only after the sequence had been matched by the recognition element. It was a classic combination of collaborators-spotter and executor, drone and rocket, Bonnie and Clyde.
Siddhartha Mukherjee (The Gene: An Intimate History)
It was the magnesium. The addition of the ion was critical: with the solution supplemented with magnesium, the ribosome remained glued together, and Brenner and Jacob finally purified a miniscule amount of the messenger molecule out of bacterial cells. It was RNA, as expected-but RNA of a special kind. The messenger was generated afreah when a gene was translated. Like DNA, these RNA molecules were built by stringing together four bases-A,G,C, and U (in the RNA copy of a gene, remember, the T found in DNA is substituted for U). Notably, Brenner and Jacob later discovered the messenger RNA was a facsimile of the DNA chain-a copy made from the original. The RNA copy of a gene then moved from the nucleus to the cytosol, where its message was decoded to build a protein. The messenger RNA was neither an inhabitant of heaven nor of hell-but a professional go-between. The generation of an RNA copy of a gene was termed transcription-referring to the rewriting of a word or sentence in a language close to the original. A gene's code (ATGGGCC...) was transcribed into an RNA code (AUGGGCC...).
Siddhartha Mukherjee (The Gene: An Intimate History)
is dynamic. “Experts” frequently differ on scientific questions and their opinions can vary in accordance with and demands of politics, power, and financial self-interest. Nearly every lawsuit I have ever litigated pitted highly credentialed experts from opposite sides against each other, with all of them swearing under oath to diametrically antithetical positions based on the same set of facts. Telling people to “trust the experts” is either naive or manipulative—or both. All of Dr. Fauci’s intrusive mandates and his deceptive use of data tended to stoke fear and amplify public desperation for the anticipated arrival of vaccines that would transfer billions of dollars from taxpayers to pharmaceutical executives and shareholders. Some of America’s most accomplished scientists, and the physicians leading the battle against COVID in the trenches, came to believe that Anthony Fauci’s do-or-die obsession with novel mRNA vaccines—and Gilead’s expensive patented antiviral, remdesivir—prompted him to ignore or even suppress effective early treatments, causing hundreds of thousands of unnecessary deaths while also prolonging the pandemic
Robert F. Kennedy Jr. (The Real Anthony Fauci: Bill Gates, Big Pharma, and the Global War on Democracy and Public Health)
Second, the production of RNA Messages was coordinately regulated. When the sugar source was switched to lactose, the bacteria turned on an entire module of genes-several lactose-metabolizing genes-to digest lactose. One of the genes in the module specified a "transporter protein" that allowed lactose to enter the bacterial cell. Another gene encoded an enzyme that was needed to break down lactose into parts. Yet another specified an enzyme to break those chemical parts into subparts. Surprisingly, all the genes dedicated to a particular metabolic pathway were physically present next to each other on the bacterial chromosome-like library books stacked by subject-and they were induced simultaneously in cells. The metabolic alteration produced a profound genetic alteration in a cell. It wasn't just a cutlery switch; the whole dinner service was altered in a single swoop. A functional circuit of genes was switched on and off, as if operated by a common spool or a master switch. Monod called one such gene module an operon. The genesis of proteins was thus perfectly synchronized with the requirements of the environment: supply the correct sugar, and a set of sugar-metabolizing genes would be turned on together.
Siddhartha Mukherjee (The Gene: An Intimate History)
Through much resistance on my part, you made it easy, and it was so different from basic relationships or familial love. I didn’t know what it was about you that made things so peculiar. You talk about your scent fetish, but as it turned out, I was also addicted to yours. It wasn’t a game for me, and I felt it much deeper than I can probably even describe in words—the combining of souls. If you weren’t around, I found myself missing you; I found myself needing you. My body, my mind, and my spirit need you. I am the world’s biggest fool, the biggest pain in the ass, but I’m stupidly, unapologetically, and whole-heartedly in love with you. I’ve waited so long to tell you that." -Tara
R.N.A. (Parasite (Para-Series #1))
Working independently, Baltimore and Temin discovered an enzyme found in retroviruses that could build DNA from an RNA template. They called the enzyme reverse transcriptase-"reverse" because it inverted the normal direction of information flow: from RNA back to DNA, or from a gene's message backward to a gene, thereby violating Crick's "central dogma" (that genetic information only moved from genes to messages, but never backward). Using reverse transcriptase, ever RNA in a cell could be used as a template to build its corresponding gene. A biologist could thus generate a catalog, or "library" of all "active" genes in a cell-akin to a library of books grouped by subject. There would be a library of genes for T cells and another for red blood cells, a library for neurons in the retina, for insulin-secreting cells of the pancreas, and so forth. By comparing libraries derived from two cells-a T cell and a pancreas cell, say-an immunologist could fish out genes that were active in one cell and not the other (e.g., insulin or the T cell receptor). Once identified, that gene could be amplified a millionfold in bacteria. The gene could be isolated and sequenced, its RNA and protein sequence determined, its regulatory regions identified; it could be mutated an inserted into a different cell to decipher the gene's structure and function. In 1984 this technique was deployed to clone the T cell receptor-a landmark achievement in immunology.
Siddhartha Mukherjee (The Gene: An Intimate History)
As an anology, consider the word structure. In bacteria, the gene is embedded in the genome in precisely that format, structure, with no breaks, stuffers, interpositions, or interruptions. In the human genome, in contrast, the word is interrupted by intermediate stretches of DNA: s...tru...ct...ur...e. The long stretches of DNA marked by the ellipses (...) do not contain any protein-encoding information. When such an interrupted gene is used to generate a message-i.e., when DNA is used to build RNA-the stuffer frragments are excised from the RNA message, and the RNA is stitched together again with the intervening pieces removed: s...tru...ct...ur...e became simplified to structure. Roberts and Sharp later coined a phrase for the process: gene splicing or RNA splicing (since the RNA message of the gene was "spliced" to removed the stuffer fragments). At first, this split structure of genes seemed puzzling: Why would an animal genome waste such long stretches of DNA splitting genes into bits and pieces, only to stitch them back into a continuous message? But the inner logic of split genes soon became evident: by splitting genes into modules, a cell could generate bewildering combinations of messages out of a single gene. The word s...tru...c...t...ur...e can be spliced to yield cure and true and so forth, thereby creating vast numbers of variant messages-called isoforms-out of a single gene. From g...e...n...om...e you can use splicing to generate gene, gnome, and om. And modular genes also had an evolutionary advantage: the individual modules from different genes could be mixed and matched to build entirely new kinds of genes (c...om...e...t). Wally Gilbert, the Harvard geneticist, created a new word for these modules; he called them exons. The inbetween stuffer fragments were termed introns.
Siddhartha Mukherjee (The Gene: An Intimate History)
Flagyl was clearly effective in the treatment of Lyme disease. But how did it work? As early as 1967 The British Journal of Venereal Diseases had published a study showing Flagyl to be effective in certain cases of syphilis, and that it had an effect on bacterial DNA and RNA irrespective of bacterial replication. Could this be the mechanism of Flagyl’s action against Burrelia burgdorferi? The key to Flagyl’s effectiveness on Lyme, however, was not reported until several months after my study was presented. Dr. O. Brorson, a Norwegian researcher, published a paper on Flagyl and its effect on the cystic forms of Lyme disease six months after I presented my research. The cystic form of Lyme disease, it turns out, is one mechanism that Borrelia burgdorferi utilizes to persist in the body. Dr. Brorson reported that Flagyl would cause Borrelia cysts to rupture, and he went on to publish that he could see under the microscope the cell wall forms of Borrelia burgdorferi (helical/spiral–shaped organisms) transform into cystic forms, and under proper conditions convert back into mobile spirochetes. A review of the medical literature revealed that these cystic forms had, in fact, been reported in syphilis. No one had clearly made the link between Borrelia and a cystic form of the organism that could persist for long periods of time in a dormant state. It was a highly evolved survival mechanism that would allow the organism to reemerge when conditions were optimal. My patient, Mary, had been treated initially with Plaquenil, which according to Dr. Brorson’s research also affects the cystic forms, yet it appeared that it was not powerful enough to destroy the dormant forms and prevent a relapse, or to prevent her from passing it on to her fetus. She had also been treated with drugs that addressed the cell wall and intracellular forms of Lyme. Although Plaquenil has some effect on cystic forms, it is often primarily used in antibiotic regimens with Lyme disease to alkalize the intracellular compartment, modulate autoimmune reactions, and affect essential enzymes necessary for bacterial replication. Clearly, however, it is not powerful enough to destroy enough of the
Richard I. Horowitz (Why Can't I Get Better?: Solving the Mystery of Lyme & Chronic Disease)
A virus particle is a very small capsule made of proteins locked together in a mathematical pattern. The pattern of the interlocking proteins in a virus is far more complicated than a snowflake. The protein capsule is sometimes wrapped in an oily membrane. Inside the capsule there is a small amount of DNA or RNA, the molecules that contain the genetic code of the virus. The genetic code is the virus’s operating system, or wetware, the complete set of instructions for the virus to make copies of itself. Unlike a snowflake or any other kind of crystal, a virus is able to re-create its form. It would be as if a single snowflake started copying itself as it falls, and those copies of the snowflake copy themselves, creating ever-growing numbers of identical copies of the first snowflake, until the air is filled with falling snow, and each flake is a perfect replica of the first flake. Many virologists feel that viruses are not truly living things. At the same time, viruses are obviously not dead. Virologists like to describe them as life forms. The term is a contradiction: How can something be a form of life that isn’t alive? Viruses carry on their existence in a misty borderland that lies between life and death, a gray zone where the things we encounter are neither provably alive nor certainly dead. One way to understand viruses is to think about them as biological machines. A virus is a wet nanomachine, a tiny, complicated, slightly fuzzy mechanism, which is rubbery, flexible, wobbly, and often a little bit imprecise in its operation—a microscopic nugget of squishy parts. Viruses are subtle, logical, tricky, reactive, devious, opportunistic. They are constantly evolving, their forms steadily changing as time passes. Like all kinds of life, viruses possess a relentless drive to reproduce themselves so that they can persist through time. When a virus starts copying itself strongly and rapidly in a host, the process is called virus amplification. As a virus amplifies itself in its host, the host, a living organism, can be destroyed. Viruses are the undead of the living world, the zombies of deep time. Nobody knows the origin of viruses—how they came into existence or when they appeared in the history of life on earth. Viruses may be examples or relics of life forms that operated at the dawn of life. Viruses may have come into existence with the first stirrings of life on the planet, roughly four billion years ago. Or they may have arisen after life started, during the time when single-celled bacteria had already come into existence—nobody knows.
Richard Preston (Crisis in the Red Zone: The Story of the Deadliest Ebola Outbreak in History, and of the Outbreaks to Come)
The trends speak to an unavoidable truth. Society's future will be challenged by zoonotic viruses, a quite natural prediction, not least because humanity is a potent agent of change, which is the essential fuel of evolution. Notwithstanding these assertions, I began with the intention of leaving the reader with a broader appreciation of viruses: they are not simply life's pathogens. They are life's obligate partners and a formidable force in nature on our planet. As you contemplate the ocean under a setting sun, consider the multitude of virus particles in each milliliter of seawater: flying over wilderness forestry, consider the collective viromes of its living inhabitants. The stunnig number and diversity of viruses in our environment should engender in us greater awe that we are safe among these multitudes than fear that they will harm us. Personalized medicine will soon become a reality and medical practice will routinely catalogue and weigh a patient's genome sequence. Not long thereafter one might expect this data to be joined by the patient's viral and bacterial metagenomes: the patient's collective genetic identity will be recorded in one printout. We will doubtless discover some of our viral passengers are harmful to our health, while others are protective. But the appreciation of viruses that I hope you have gained from these pages is not about an exercise in accounting. The balancing of benefit versus threat to humanity is a fruitless task. The viral metagenome will contain new and useful gene functionalities for biomedicine: viruses may become essential biomedical tools and phages will continue to optimize may also accelerate the development of antibiotic drug resistance in the post-antibiotic era and emerging viruses may threaten our complacency and challenge our society economically and socially. Simply comparing these pros and cons, however, does not do justice to viruses and acknowledge their rightful place in nature. Life and viruses are inseparable. Viruses are life's complement, sometimes dangerous but always beautiful in design. All autonomous self-sustaining replicating systems that generate their own energy will foster parasites. Viruses are the inescapable by-products of life's success on the planet. We owe our own evolution to them; the fossils of many are recognizable in ERVs and EVEs that were certainly powerful influences in the evolution of our ancestors. Like viruses and prokaryotes, we are also a patchwork of genes, acquired by inheritance and horizontal gene transfer during our evolution from the primitive RNA-based world. It is a common saying that 'beauty is in the eye of the beholder.' It is a natural response to a visual queue: a sunset, the drape of a designer dress, or the pattern of a silk tie, but it can also be found in a line of poetry, a particularly effective kitchen implement, or even the ruthless efficiency of a firearm. The latter are uniquely human acknowledgments of beauty in design. It is humanity that allows us to recognize the beauty in the evolutionary design of viruses. They are unique products of evolution, the inevitable consequence of life, infectious egotistical genetic information that taps into life and the laws of nature to fuel evolutionary invention.
Michael G. Cordingley (Viruses: Agents of Evolutionary Invention)
In most life forms, genes are stretched out along the length of a filament-like molecule of DNA, deoxyribonucleic acid. But many viruses—including influenza, HIV, and the coronavirus that causes SARS (severe acute respiratory syndrome)—encode their genes in RNA, ribonucleic acid, an even simpler but less stable molecule.
John M. Barry (The Great Influenza: The Epic Story of the Deadliest Plague in History)
negative copy of the gene is then assembled, forming a molecule known as messenger RNA (mRNA). This mRNA is used as the template for assembling the growing protein.
Thomas Horn (Pandemonium's Engine: How the End of the Church Age, the Rise of Transhumanism, and the Coming of the bermensch (Overman) Herald Satans Imminent and Final Assault on the Creation of God)
In DNA, the alphabetic instructions are adenine, thymine, cytosine, and guanine. One way to recognize mRNA in the cell is that it does not contain thymine, but substitutes uracil instead. The mRNA is then composed of a collection of these four bases (a, u, c, and g). It takes only three bases to form what is called a “codon.” This codon corresponds to an amino acid. A large protein called a ribosome works like a tiny machine, moving along the mRNA strand, while transfer RNA (tRNA) units attach, encoding one of twenty amino acids. The string of amino acids form into a protein.[353]
Thomas Horn (Pandemonium's Engine: How the End of the Church Age, the Rise of Transhumanism, and the Coming of the bermensch (Overman) Herald Satans Imminent and Final Assault on the Creation of God)
A problem was how nature punctuated the seemingly unbroken DNA and RNA strands. No one could see a biological equivalent for the pauses that separate letters in Morse code, or the spaces that separate words. Perhaps every fourth base was a comma. Or maybe (Crick suggested) commas would be unnecessary if some triplets made “sense” and others made “nonsense.” Then again, maybe a sort of tape reader just needed to start at a certain point and count off the nucleotides three by three. Among the mathematicians drawn to this problem were a group at the new Jet Propulsion Laboratory in Pasadena, California, meant to be working on aerospace research. To them it looked like a classic problem in Shannon coding theory: “the sequence of nucleotides as an infinite message, written without punctuation, from which any finite portion must be decodable into a sequence of amino acids by suitable insertion of commas.” They constructed a dictionary of codes. They considered the problem of misprints
James Gleick (The Information: A History, a Theory, a Flood)
This dsDNA can then incorporate itself into the host chromosome using a viral enzyme called “integrase.” The new “fake gene” then orders the cell to make more mRNA copies of the original virus RNA. These then travel out of the cell and infect the next cell, and so on.
Cris Putnam (Exo-Vaticana: Petrus Romanus, Project LUCIFER, and the Vatican's Astonishing Exo-Theological Plan for the Arrival of an Alien Savior)
The combination of amino acids into proteins and of nucleic acids into strings of RNA established the basic paradigm of biology. Strings of RNA (and later DNA) that self-replicated (Epoch Two) provided a digital method to record the results of evolutionary experiments. Later on, the evolution of a species that combined rational thought (Epoch Three) with an opposable appendage (the thumb) caused a fundamental paradigm shift from biology to technology (Epoch Four). The upcoming primary paradigm shift will be from biological thinking to a hybrid combining biological and nonbiological thinking (Epoch Five), which will include “biologically inspired” processes resulting from the reverse engineering of biological brains.
Ray Kurzweil (The Singularity is Near)
Holger Hyden discovers that the brain cells of educated rats contain a third more RNA the those of uneducated rats. University of California psychologists pass on learning from one rat to another by injecting RNA from trained rats. Neurologists are "wiring up" the brains of animals and men and altering consciousness by pressing buttons. Press a button - make him hungry. Press a button - make him horny. Press a button - make him angry. Press a button - make him happy. The psychedelic chemicals flood out of the laboratories. Into the hands of the two familiar groups; those who want to do something to others for power and control; those who want to do something to themselves for fun and love.
Timothy Leary (The Politics of Ecstasy)
I absolutely can’t stand science, especially biology, which was what we were studying. I couldn’t keep all those terms straight: cell and nucleus, species and phylum and genus, RNA and DNA and who knows what else. You know what is really stupid? The word species. If you have two different kinds of animals or something, then you have two species. But if you have only one kind, then you still have a species. Why not a specie? Or a specy? You don’t have two cats and one cats. Oh, well.
Ann M. Martin (Claudia and the Great Search (The Baby-Sitters Club, #33))
Infrared light therapy stimulates production of collagen, ribonucleic acid (RNA), ATP, and deoxyribonucleic acid (DNA), which enhances the body’s cellular repair rejuvenation systems, providing relief from pain and shortening recovery time.
Joanne Hillyer (Infrared Sauna Therapy: Lose Weight, Live Longer, Look Younger, and Heal Faster with Sauna Therapy)
I do have an interest in dissidents. My mother believes 5G may harm us, and I think she’s silly. But what of the nonconformist who warned back in 1940 that cigarettes kill? What of the contrarian who said the CIA was spying on Martin Luther King, Jr.? I mean, I’ve seen no evidence that 5G or the Covid vaccines are harmful. But have I done that research myself? No. I just trust the media would tell me if they were. My media. Whatever media my mom is consuming, they’re quoting “research, studies.” They’re slinging medical articles and YouTube videos of doctors saying that mRNA vaccines kill. A month before our road trip, she sent me one of these videos. It’s a clip of a longer talk, but even the clip is twelve minutes long. “Something to consider,” she wrote in the subject line. “Doctor calls out deadly vaccine!” Twelve minutes is annoyingly long for something I instinctively discredit, but short enough to give it a go. So I do. It’s a doctor on a stage with a PowerPoint. He has studies and graphs and lists of ingredients in tiny fonts and words like “embryonic stem cells.” I write my mom a long response. “OK I’m six minutes in and here are my thoughts: he’s using a lot of technical science speak that is above my pay grade. And so, what I’m doing is I’m trusting the lingo of an expert.
Jedidiah Jenkins (Mother, Nature: A 5,000-Mile Journey to Discover if a Mother and Son Can Survive Their Differences)
This doctrine has been rejected as a form of magical thinking, but the New Biology explains a possible scientific mechanism by which these two seemingly unrelated entities—the walnut and the human brain—mirror one another so literally and poetically. Because plants and animals have co-evolved intimately over countless millennia and have become dependent on one another for various functions, the visual homologies may speak to the existence of an informational bridge through which genetic/epigenetic information has flowed. Thanks to the New Biology, we now know that exosomes allow plants and animals to share RNA-coded genetic information of significant impact with one another. As the entire biosphere participates in this exosome-based information-sharing network, it is plausible the resemblance of walnuts to the mammalian brain reflects their intimate genetic connection and interdependency? Not surprisingly, abundant research has established that walnuts boost cognition, including inferential verbal reasoning abilities,66 especially supporting the brain health of the elderly when consumed daily. Researchers from Harvard University and Brigham and Women’s Hospital estimated that women who are 70 years or older saw a reduction in cognitive decline equivalent to two years.67
Sayer Ji (Regenerate: Unlocking Your Body's Radical Resilience through the New Biology)
Salt helps RNA fold. What if he experimented with depriving the RNA of salt? This didn’t work either. Steve was disappointed. But not devastated, as he might have been had Jen not worked so hard to create an environment in the lab where the focus is on learning and discovery. As she explains, “High-performing individuals aren’t used to making mistakes. It’s important to learn to laugh at ourselves or we’ll err on the side of being too afraid to try.” Her passion for the central role embracing failure plays in science research has led Heemstra to write about how students, and especially women, can easily be discouraged from pursuing careers in science, stating in a tweet, “The only people who never make mistakes and never experience failure are those who never try.
Amy C. Edmondson (Right Kind of Wrong: The Science of Failing Well)
That the protein failed to bind on double-stranded DNA when it had succeeded in binding on single-stranded RNA was not, however, a “silly mistake.” It was the undesired result of a hypothesis-driven experiment. A failure, yes, but an intelligent failure—and an inevitable part of the fascinating work of science. Most important, that failure would inform the next experiment.
Amy C. Edmondson (Right Kind of Wrong: The Science of Failing Well)
stress-induced irregularities in microRNA levels can affect how genes are expressed in multiple generations.30
Mark Wolynn (It Didn't Start with You: How Inherited Family Trauma Shapes Who We Are and How to End the Cycle)
The skeptical and frequently hostile reactions to prions from many precincts of the scientific community reflected resistance to a profound change in thinking. Prions were seen as an anomaly: they reproduce and infect but contain no genetic material—neither DNA nor RNA; thus they constitute a disruptive transition in our understanding of the biological world.
Stanley B. Prusiner (Madness and Memory: The Discovery of Prions--A New Biological Principle of Disease)
ta-rna rna rna rom!
J.R.R. Tolkien (The Lord of the Rings)
Based on the number of reports received, people are more than 150 times as likely to die after receiving a Covid shot than the flu vaccine. But that difference underestimates the real ratio of death reports per vaccination, because people must receive two shots of the mRNA vaccines to be fully vaccinated. Fewer than 40 million people had received two doses in mid-March, meaning that death reports were roughly 500 times as likely to come in following Covid vaccinations.
Alex Berenson (Unreported Truths About Covid-19 and Lockdowns: Part 4: Vaccines)
new multibillion-dollar government initiative to use taxpayer money and NIAID-patented mRNA technology to prepare distinct new vaccines for twenty families of viruses
Robert F. Kennedy Jr. (The Real Anthony Fauci: Bill Gates, Big Pharma, and the Global War on Democracy and Public Health)
On Degenerate Templates and the Adaptor Hypothesis: A Note for the RNA Tie Club,” which Crick sent out early in 1955, is the first of his master-works about protein synthesis and the coding problem. By 1966, he had written two dozen papers related to the subject. Six at least were of great and general importance. Two of those included experiments and were written with collaborators. One more paper, of pleasing ingenuity, happened to be wrong: nature turned out to be less elegant than Crick’s imagination. Of the entire run, however, this first was the most unprecedented and original. The paper defined the next questions, and many were new questions. More, it established the way the questions were to be approached, and the terms in which they were to be argued. Most generally, it took for granted that the questions were spatial, physical, logical, easy to apprehend, and therefore tractable and even—in principle—simple. Yet even now, only a few hundred people have ever read the paper—for the surprising reason that it has never been published. It remained a note for the RNA Tie Club: seventeen foolscap pages, typewritten, double-spaced, mimeographed.
Horace Freeland Judson (The Eighth Day of Creation: Makers of the Revolution in Biology)
The most fundamental objection to Gamow’s scheme is that it does not distinguish between the direction of a sequence; that is, between Thr. Pro. Lys. Ala. and Ala. Lys. Pro. Thr…. There is little doubt that Nature makes this distinction, though it might be claimed that she produces both sequences at random, and that the “wrong” ones—not being able to fold up—are destroyed. This seems to me unlikely. That observation, made in passing, was the first acknowledgment of a theoretical question that is still unanswered: in general terms, what does the cell do with information it possesses on the DNA—and some organisms possess some DNA sequences in thousands of copies—that it does not use to code for proteins? This difficulty brings us face-to-face with one of the most puzzling features of the DNA structure—the fact that it is non-polar, due to the dyads at the side; or put another way, that one chain runs up while the other runs down. It is true that this only applies to the backbone, and not to the base sequence, as Delbrück has emphasized to me in correspondence. This may imply that a base sequence read one way makes sense, and read the other way makes nonsense. Another difficulty is that the assumptions made about which diamonds are equivalent are not very plausible…. [Gamow’s idea] would not be unreasonable if the amino acid could fit on to the template from either side, into cavities which were in a plane, but the structure certainly doesn’t look like that. The bonds seem mainly to stick out perpendicular to the axis, and the template is really a surface with knobs on, and presents a radically different aspect on its two sides…. What, then are the novel and useful features of Gamow’s ideas? It is obviously not the idea of amino acids fitting on to nucleic acids, nor the idea of the bases sequence of the nucleic acids carrying the information. To my mind Gamow has introduced three ideas of importance: (1) In Gamow’s scheme several different base sequences can code for one amino acid…. This “degeneracy” seems to be a new idea, and, as discussed later, we can generalise it. (2) Gamow boldly assumed that code would be of the overlapping type…. Watson and I, thinking mainly about coding by hypothetical RNA structures rather than by DNA, did not seriously consider this type of coding. (3) Gamow’s scheme is essentially abstract. It originally paid lip service to structural considerations, but the position was soon reached when “coding” was looked upon as a problem in itself, independent as far as possible of how things might fit together…. Such an approach, though at first sight unnecessarily abstract, is important. Finally it is obvious to all of us that without our President the whole problem would have been neglected and few of us would have tried to do anything about it.
Horace Freeland Judson (The Eighth Day of Creation: Makers of the Revolution in Biology)
The conclusion is inescapable: Crick in Cambridge and Brenner in Johannesburg were thinking well ahead of the biochemical pack. But then, about fifteen minutes later in that same discussion, Walter Sampson Vincent, an instructor in anatomy from the State University of New York at Syracuse, got up to report some experiments with the RNA of unfertilized egg cells of starfish. “Both Dr. Borsook and Dr. Zamecnik have suggested that there should be two RNA fractions in the cell, with differing characteristics,” Vincent said. He had found the same thing himself, and proceeded to tell how, at length. His biological specimens—starfish eggs—were unfamiliar; his methods were the well-known ones of Torbjörn Caspersson and Jean Brachet (he had spent a year with Brachet as a postdoc); and worse than that, late in such a meeting, when scientist after scientist has risen to talk about his experiments, however tenuously related to the chief topic, the audience gets numb and drifts away. Vincent’s data suggested, he said in conclusion, that the nucleus contained two classes of RNA, “one a soluble, metabolically very active, fraction, representing only a small portion of the total.” His last words were about that fraction: “One exciting implication of the active, or labile, form would be that it is involved in the transfer of nuclear ‘information’ to the synthetic centers of the cytoplasm.” This astonishing suggestion went unnoticed.
Horace Freeland Judson (The Eighth Day of Creation: Makers of the Revolution in Biology)
Fränkel-Conrat seems to have done the biggest thing with TMV, since Stanley crystallized it. He can add soluble TMV protein to soluble TMV RNA, aggregate the whole mess into rods of which 0.1% are infective!!! Naturally, you don’t believe it—neither did I nor anyone else, but unless he has made up the whole thing it now seems that it must be true. You can’t beat that for laughs, can you Buddy? Heinz Fraenkel-Conrat had taken particles of tobacco-mosaic virus apart, which had been done before—and then had successfully put them back together again. The virus is made of one long single strand of RNA and a large number of identical protein subunits—2,130 of these, it is now known, each a single polypeptide chain folded into a shape like the first joint of a thumb. As Watson had glimpsed in the summer of 1952, these subunits join up, side to side but slightly askew, to form a helix with all the thumbs pointing out. The overall shape is a rod with a hole down the middle like a short piece of macaroni. The subunits are held together by weak bonds between certain charged amino-acid side chains. The central hole is twenty angstroms across, and is empty. But the protein units, assembled, have a long continuous internal groove winding up beyond the wall of the central hole. In this groove lies the strand of RNA—which explains the discovery, which had intrigued Watson and everyone else, that all its phosphate groups lie at a common radius. By treatment with mild acid, Fraenkel-Conrat neutralized the charges that hold the protein subunits together, and the rod fell apart and stopped being infectious. He then separated and purified the protein. In a separate, parallel step, he treated virus particles with detergent to strip away the protein to allow the RNA to be recovered. Then he mixed the subunits and the RNA strands in solution once more—and got out normal infectious particles. With the electron microscope, Robley Williams confirmed that whole virus particles were there. The virus assembled itself: the architecture of the complete particle seemed to be an inbuilt consequence of the structure of the protein subunits.
Horace Freeland Judson (The Eighth Day of Creation: Makers of the Revolution in Biology)
safe, inexpensive, well-known, and readily available drug had demolished SARS-CoV-2 in cell cultures. “We found that even a single dose could essentially remove all viral RNA by 48 hours and that even at 24 hours there
Robert F. Kennedy Jr. (The Real Anthony Fauci: Bill Gates, Big Pharma, and the Global War on Democracy and Public Health)