Nick Land Quotes

We've searched our database for all the quotes and captions related to Nick Land. Here they are! All 100 of them:

Space echoes like an immense tomb, yet the stars still burn. Why does the sun take so long to die ?
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
I will fear no evil for I am the baddest beast in the land. (Nick)
Sherrilyn Kenyon (Infinity (Chronicles of Nick, #1))
Whenever its name has been anything but a jest, philosophy has been haunted by a subterranean question: What if knowledge were a means to deepen unknowing?
Nick Land (Fanged Noumena: Collected Writings, 1987–2007)
Nothing human makes it out of the near-future.
Nick Land
In the land of Bad Ass, Acheron reigned supreme.
Sherrilyn Kenyon (Infamous (Chronicles of Nick, #3))
Do we really lack the delicacy to let God die quietly, on his own, like a dog?
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
Books are, let's face it, better than everything else. If we played cultural Fantasy Boxing League, and made books go 15 rounds in the ring against the best that any other art form had to offer, then books would win pretty much every time. Go on, try it. “The Magic Flute” v. Middlemarch? Middlemarch in six. “The Last Supper” v. Crime and Punishment? Fyodor on points. See? I mean, I don’t know how scientific this is, but it feels like the novels are walking it. You might get the occasional exception -– “Blonde on Blonde” might mash up The Old Curiosity Shop, say, and I wouldn’t give much for Pale Fire’s chance against Citizen Kane. And every now and again you'd get a shock, because that happens in sport, so Back to the Future III might land a lucky punch on Rabbit, Run; but I'm still backing literature 29 times out of 30.
Nick Hornby (The Polysyllabic Spree)
...the principal role of conservatism in modern politics is to be humiliated. That is what a perpetual loyal opposition, or court jester, is for.
Nick Land (The Dark Enlightenment)
Neo-China arrives from the future.
CCRU (Ccru: Writings 1997-2003)
Do not, I beg of you, dampen today's sun with the showers of tomorrow." - Emperor Nick Chopper (The Tin Woodsman) -The Marvellous Land Of Oz by L. Frank Baum pg 86 chapter 11
L. Frank Baum (The Marvelous Land of Oz (Oz, #2))
Machinic desire can seem a little inhuman, as it rips up political cultures, deletes traditions, dissolves subjectivities, and hacks through security apparatuses, tracking a soulless tropism to zero control. This is because what appears to humanity as the history of capitalism is an invasion from the future by an artificial intelligent space that must assemble itself entirely from its enemy's resources.
Nick Land (Fanged Noumena: Collected Writings, 1987–2007)
That is the purpose for which you are called hither. Called, is say, though I have not called you to me, strangers from distant lands. You have come and are here met, in this very nick of time, by chance as it may seem. Yet it is not so. Believe rather that it is so ordered that we, who sit here, and none others, must now find counsel for the peril of the world.
J.R.R. Tolkien (The Fellowship of the Ring (The Lord of the Rings, #1))
Level-1 or world space is an anthropomorphically scaled, predominantly vision-configured, massively multi-slotted reality system that is obsolescing very rapidly. Garbage time is running out. Can what is playing you make it to level-2?
Nick Land
Suffering must be obviously futile if it is to be 'educational'. It is for this reason that our history is so unintelligible, and indeed, nothing that was true has ever made sense. 'Why was so much pain necessary?' we foolishly ask. But it is precisely because history has made no sense that we have learnt from it, and the lesson remains a brutal one.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
After all, the ideal of bourgeois politics is the absence of politics, since capital is nothing other than the consistent displacement of social decision-making into the marketplace
Nick Land (Fanged Noumena: Collected Writings, 1987–2007)
If there is a conclusion it is zero.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
It is a mere consolation to the timid to imagine that philosophy has died. The fact of the matter is quite to the contrary. Philosophy will be the last of human things; perhaps the efficient impulse of the end.
Nick Land
Ever since it became theoretically evident that our precious personal identities were just brand-tags for trading crumbs of labour-power on the libidino-economic junk circuit, the vestiges of authorial theatricality have been wearing thinner.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
Organs crawl like aphids upon the immobile motor of becoming
Nick Land (Fanged Noumena: Collected Writings, 1987–2007)
Matter signals to its lost voyagers, telling them that their quest is vain, and that their homeland already lies in ashes behind them.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
All health, beauty, intelligence, and social grace has been teased from a vast butcher’s yard of unbounded carnage, requiring incalculable eons of massacre to draw forth even the subtlest of advantages. This is not only a matter of the bloody grinding mills of selection, either, but also of the innumerable mutational abominations thrown up by the madness of chance, as it pursues its directionless path to some negligible preservable trait, and then — still further — of the unavowable horrors that ‘fitness’ (or sheer survival) itself predominantly entails. We are a minuscule sample of agonized matter, comprising genetic survival monsters, fished from a cosmic ocean of vile mutants, by a pitiless killing machine of infinite appetite. (This is still, perhaps, to put an irresponsibly positive spin on the story, but it should suffice for our purposes here.)
Nick Land
Lie there, lie there, little Henry Lee Till the flesh drops from your bones For the girl you have in that merry green land Can wait forever for you to come home. And the wind did howl... and the wind did moan...
Nick Cave (Murder Ballads)
One ascends into profundity, but profundity is nothing but a complication of the shallows, and 'one' is nowhere.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
Far from being the acme of religion — let alone its telic blossoming — God is the principle of its suppression. The unity of theos is the tombstone of sacred zero, the crumbling granitic foundation of secular destitution.
Nick Land (Fanged Noumena: Collected Writings, 1987–2007)
I will fear no evil for I am the baddest beast in the land. I am the power they can't tear down. And my will is law.
Sherrilyn Kenyon (Infinity (Chronicles of Nick, #1))
When he had gone home, he had been frightened, he had refused to face what he saw. But he had not really wanted to come home to a land, only to a pas; and not finding the past there, he had run away, fearing the reality, preferring the dream.
Nick Joaquín (The Woman Who Had Two Navels)
The arc of history is long, but it bends towards zombie apocalypse.
Nick Land (The Dark Enlightenment)
Panicked, she dropped the suitcase and started edging away. In her haste she caught the backs of her knees on the arm of the sofa, lost her balance and landed flat on her back on the cushions. His eyes gleaming with amusement, Nick looked at the delectable beauty sprawled invitingly across the sofa. "I'm flattered,honey, but I'd like something to eat first.What are you serving-besides baked shoes?
Judith McNaught (Double Standards)
The boat has become supreme isolation, chosen isolation, holding myself apart from the world, which I only dimly understand anyway. I can sit on the aft deck and never be surprised by anything again- no phone will ever ring, no one will knock that I haven't seen coming for a quarter mile. that I can go to sleep any night and wake up having broken loose- a failed knot, a line frayed, the anchor dragged- that I can drift out of sight of land makes a twisted sense, in line with my internal weather. When everything has proven tenuous one can either move toward permanence or toward impermanence. The boat's sublimely impermanent. Some mornings the fog's so thick that I exist only in a tight globe of clearing, beyond which is all foghorn and unknown.
Nick Flynn (Another Bullshit Night in Suck City)
The unconscious does not coo sweet lyrics or unroll immaculate and measured prose, it howls and raves like the shackled and tortured beast that our civilization has made of it, and when the fetters are momentarily loosened the unconscious does not thank the ego for this meagre relief, but hisses, spits, and bites, as any wild thing would.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
One 'is' a genius only in the sense that one 'is' a syphilitic, in the sense that 'one' is violently problematized by a ferocious exteriority. One returns to the subject of which genius has been predicated to find it charred and devastated beyond recognition.
Nick Land
Also-and this is critical-you are not ugly." She blinked. Nick's eyes danced with amusement. "Remember, Isabel. It was your brother who said it. I would not dare to take credit for such pretty words. I would have said something more pedestrian. It takes a great orator to come up with -" "Not ugly." She gave a little shake of her head. "What a lovely compliment.
Sarah MacLean (Ten Ways to Be Adored When Landing a Lord (Love By Numbers, #2))
London is one of the world's centres of Arab journalism and political activism. The failure of left and right, the establishment and its opposition, to mount principled arguments against clerical reaction has had global ramifications. Ideas minted in Britain – the notion that it is bigoted to oppose bigotry; 'Islamophobic' to oppose clerics whose first desire is to oppress Muslims – swirl out through the press and the net to lands where they can do real harm.
Nick Cohen
Five hundred years ago the notoriously savvy Henry VIII discovered an elegant way to solve both his theological problems and his personal liquidity crisis - he dissolved the monasteries and nicked all their land. Since the principle of any rich person who wants to stay rich is, never give anything away unless you absolutely have to, the land has stayed with Crown ever since.
Ben Aaronovitch (Moon Over Soho (Rivers of London, #2))
Even a life raft is only supposed to get you from the sinking ship back to land, you were never intended to live in the life raft, to drift years on end, in sight of land but never close enough.
Nick Flynn (Another Bullshit Night in Suck City)
[[ ]] The story goes like this: Earth is captured by a technocapital singularity as renaissance rationalization and oceanic navigation lock into commoditization take-off. Logistically accelerating techno-economic interactivity crumbles social order in auto sophisticating machine runaway. As markets learn to manufacture intelligence, politics modernizes, upgrades paranoia, and tries to get a grip. The body count climbs through a series of globewars. Emergent Planetary Commercium trashes the Holy Roman Empire, the Napoleonic Continental System, the Second and Third Reich, and the Soviet International, cranking-up world disorder through compressing phases. Deregulation and the state arms-race each other into cyberspace. By the time soft-engineering slithers out of its box into yours, human security is lurching into crisis. Cloning, lateral genodata transfer, transversal replication, and cyberotics, flood in amongst a relapse onto bacterial sex. Neo-China arrives from the future. Hypersynthetic drugs click into digital voodoo. Retro-disease. Nanospasm.
Nick Land (Fanged Noumena: Collected Writings, 1987–2007)
Geneverie fought down panic. She had to make him land this plane. "I give great blowjobs!" Nick laughed. "Wish I had the time to check that out." He continued to aim the gun right between her eyes as he reached behind him to unlatch the cabin door. (...) Nich smiled. "But maybe you'de like to treat him to one of those blowjobs. You two will have a little time on your hands. Well, so long!" He jumped.
Vicki Lewis Thompson
As soon as politicians have learnt to buy political support from the ‘public purse’, and conditioned electorates to embrace looting and bribery, the democratic process reduces itself to the formation of (Mancur Olson’s) ‘distributional coalitions’ – electoral majorities mortared together by common interest in a collectively advantageous pattern of theft.
Nick Land (The Dark Enlightenment)
Civilization, as a process, is indistinguishable from diminishing time-preference (or declining concern for the present in comparison to the future). Democracy, which both in theory and evident historical fact accentuates time-preference to the point of convulsive feeding-frenzy, is thus as close to a precise negation of civilization as anything could be, short of instantaneous social collapse into murderous barbarism or zombie apocalypse (which it eventually leads to). As the democratic virus burns through society, painstakingly accumulated habits and attitudes of forward-thinking, prudential, human and industrial investment, are replaced by a sterile, orgiastic consumerism, financial incontinence, and a ‘reality television’ political circus. Tomorrow might belong to the other team, so it’s best to eat it all now.
Nick Land (The Dark Enlightenment)
Did your dad say anything about Nick and Daisy?" "He-" I started. Then I caught a blur out of the corner of my eye, and something landed in the fountain with a resounding splash, drenching me and Jenna in a wave of pink water. Nick surfaced, tossing his head back and sending dropets flying. If a demon and a vampire both staring at him with identical looks of "WTF,dude?" bothered him, he didn't show it. Instead,he gave his usualy creepy grin and asked, "Did one of you lovely ladies say my name?" "Yeah," I said,glaring at him as I wrung water out of my braid. "We were just saying, 'Man,I wish Nick would fling himself into the fountain like a nut job and totally ruin our clothes.' So thanks for that." "Sophie's right," Daisy said, coming to stand next to the fountain. Apparently, wherever Nick was, she was right behind. "Tell them you're sorry." Her words might have sounded sterner if she hadn't been looking at Nick like he was something tasty to eat. God,they were weird. Nick sloshed through the water until he was right in front of me and Jenna. "That's actually why I came out here, my darling," he said to Daisy. "Sophie, I was a jerk to you yesterday." He didn't actually say 'jerk," but another word that was way more accurate. I just raised my eyebrows and waited for him to continue.
Rachel Hawkins (Demonglass (Hex Hall, #2))
Contempt for common evaluations; one should even take care to avoid straying accidentally into the right. Even to be an enemy is too comforting; one must be an alien, a beast. Nothing is more absurd than a philosopher seeking to be liked.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
Space is going to be the greatest genetic quality filter since the dark ages.
Nick Land
If there is something you want to protect, attack it with measured vigour yourself, thus investing it with replenished force, and pre-empting its annihilation.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
Philosophy, in its longing to rationalize, formalize, define, delimit, to terminate enigma and uncertainty, to co-operate wholeheartedly with the police, is nihilistic in the ultimate sense that it strives for the immobile perfection of death. But creativity cannot be brought to an end that is compatible with power, for unless life is extinguished, control must inevitably break down. We possess art lest we perish of the truth.
Nick Land (Fanged Noumena: Collected Writings, 1987–2007)
God is nowhere to be found, yet there is still so much light! Light that dazzles and maddens; crisp, ruthless light. Space echoes like an immense tomb, yet the stars still burn. Why does the sun take so long to die? Or the moon retain such fidelity to the Earth? Where is the new darkness? The greatest of all unknowings? Is death itself shy of us?
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
Under capitalism, neither Democrat nor Republican can save Indigenous lands or Black and Indigenous lives. The continuation of state-sanctioned racial terror against Black and Native people, from police violence to energy development, from one administration to the next demonstrates only radical change in the form of decolonization, the repatriation of stolen lands and stolen lives, can undo centuries of settler colonialism.
Nick Estes (Our History Is the Future: Standing Rock Versus the Dakota Access Pipeline, and the Long Tradition of Indigenous Resistance)
We fought, Wilkie Collins and I. We fought bitterly and with all our might, to a standstill, over a period of about three weeks, on trains and aeroplanes and by hotel swimming pools. Sometimes – usually late at night, in bed – he could put me out cold with a single paragraph; every time I got through twenty or thirty pages, it felt to me as though I’d socked him good, but it took a lot out of me, and I had to retire to my corner to wipe the blood and sweat off my reading glasses. Only in the last fifty-odd pages, after I’d landed several of these blows, did old Wilkie show any signs buckling under the assault.
Nick Hornby (The Polysyllabic Spree)
Called, I say, though I have not called you to me, strangers from distant lands. You have come and are here met, in this very nick of time, by chance as it may seem. Yet it is not so. Believe rather that it is so ordered that we, who sit here, and none others, must now find counsel for the peril of the world.
J.R.R. Tolkien (The Lord of the Rings)
The great educational value of the war against Christendom lies in the absolute truthlessness of the priest. Such purity is rare enough. The 'man of God' is entirely incapable of honesty, and only arises at the point where truth is defaced beyond all legibility. Lies are his entire metabolism, the air he breathes, his bread and his wine. He cannot comment upon the weather without a secret agenda of deceit. No word, gesture, or perception is slight enough to escape his extravagant reflex of falsification, and of the lies in circulation he will instinctively seize on the grossest, the most obscene and oppressive travesty. Any proposition passing the lips of a priest is necessarily totally false, excepting only insidiouses whose message is momentarily misunderstood. It is impossible to deny him without discovering some buried fragment or reality.
Nick Land (Fanged Noumena: Collected Writings, 1987–2007)
Was Trakl a Christian? Yes, of course, at times he becomes a Christian, among a general confusion of becomings—becoming an animal, becoming a virus, becoming inorganic—just as he was also an antichrist, a poet, a pharmacist, an alcoholic, a drug addict, a psychotic, a leper, a suicide, an incestuous cannibal, a necrophiliac, a rodent, a vampire, and a werewolf. Just as he became his sister, and also a hermaphrodite. Trakl's texts are scrawled over by redemptionist monotheism, just as they are stained by narcotic fluidities, gnawed by rats, cratered by Russian artillery, charred and pitted by astronomical debris. Trakl was a Christian and an atheist and also a Satanist, when he wasn't simply undead, or in some other way inhuman. It is perhaps more precise to say that Trakl never existed, except as a battlefield, a reservoir of disease, the graveyard of a deconsecrated church, as something expiring from a massive cocaine overdose on the floor of a military hospital, cheated by lucidity by the searing onslaught of base difference.
Nick Land (Fanged Noumena: Collected Writings, 1987–2007)
Kant's great discovery—but one that he never admitted to—was that apodictic reason is incompatible with knowledge. Such reason must be 'transcendental'. This is a word that has been propagated with enthusiasm, but only because Kant simultaneously provided a method of misreading it. To be transcendental is to be 'free' of reality. This is surely the most elegant euphemism in the history of Western philosophy.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
In a world divided between theistic enthusiasts and secularist depressives there is little patience for the atheist who nurtures a passionate hatred for God. The mixture of naturalism and blasphemy that characterizes the Sadean text occupies the space of our blindness, to which Bataille’s writings are not unreasonably assimilated. If there is contradiction here it is one that is coextensive with the unconscious; the consequence of a revolt incommensurate with the ontological weight of its object. That God has wrought such loathesomeness without even having existed only exacerbates the hatred pitched against him. An atheism that does not hunger for God’s blood is an inanity, and the anaemic feebleness of secular rationalism has so little appeal that it approximates to an argument for his existence. What is suggested by the Sadean furore is that anyone who does not exult at the thought of driving nails through the limbs of the Nazarene is something less than an atheist; merely a disappointed slave.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
Scholars have an inordinate respect for long books, and have a terrible rancune against those that attempt to cheat on them. They cannot bear to imagine that short-cuts are possible, that specialism is not an inevitability, that learning need not be stoically endured. They cannot bear writers allegro, and when they read such texts—and even pretend to revere them—the result is (this is not a description without generosity) 'unappetizing'.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
After all, fear is the passionate enthusiasm for the same.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
Game Theory
Nick Land
You scrape away your face and step into the dark...
Nick Land
Hell has no interest in our debauched moral currency.
Nick Land
The infrastructure of power is human neurosoft compatible ROM. Authority instantiates itself as linear instruction pathways, genetic baboonery, scriptures, traditions, rituals, and gerontocratic hierarchies, resonant with the dominator ur-myth that the nature of reality has already been decided. If you want to find ICE, try thinking about what is blocking you out of the past. It certainly isn’t a law of nature. Temporalization decompresses intensity, installing constraint.
Nick Land (Fanged Noumena: Collected Writings, 1987–2007)
Nature or Nature’s God” is not a statement, but a name, internally divided by tolerated uncertainty. It has the singularity of a proper name, whilst parenthesizing a suspended decision (Pyrrhonian epoche, of which much more in a future post). It designates rigidly, but obscurely, because it points into epistemological darkness — naming a Reality that not only ‘has’, but epitomizes identity, whilst nevertheless, for ‘the sake of argument’, eluding categorical identification. Patient in the face (or facelessness) of who or what it is, ‘we’ emerge from a pact, with one basic term: a preliminary decision is not to be demanded. It thus synthesizes a select language community, fused by the unknown.
Nick Land
Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).
Nick Land (Fanged Noumena: Collected Writings 1987 - 2007)
To call the belief in substantial human equality a superstition is to insult superstition. It might be unwarranted to believe in leprechauns, but at least the person who holds to such a belief isn’t watching them not exist, for every waking hour of the day. Human inequality, in contrast, and in all of its abundant multiplicity, is constantly on display, as people exhibit their variations in gender, ethnicity, physical attractiveness, size and shape, strength, health, agility, charm, humor, wit, industriousness, and sociability, among countless other features, traits, abilities, and aspects of their personality, some immediately and conspicuously, some only slowly, over time. To absorb even the slightest fraction of all this and to conclude, in the only way possible, that it is either nothing at all, or a ‘social construct’ and index of oppression, is sheer Gnostic delirium: a commitment beyond all evidence to the existence of a true and good world veiled by appearances. People are not equal, they do not develop equally, their goals and achievements are not equal, and nothing can make them equal. Substantial equality has no relation to reality, except as its systematic negation. Violence on a genocidal scale is required to even approximate to a practical egalitarian program, and if anything less ambitious is attempted, people get around it (some more competently than others).
Nick Land (The Dark Enlightenment)
Of course I am. Life’s a fight. Speaking of, I’m sure you read about Shep and the New York campaign scandal. What a doozy. But somehow the guy always lands on his feet.” Daniel thinks of the letters he wrote to the embassy and the State Department about Shep Van Dorn. Nothing came of them. Nick is right. Guys like Shep always seem to land on their feet. He should have decked him when he had the chance.
Ruta Sepetys (The Fountains of Silence)
Philosophy has an affinity with despotism, due to its predilection for Platonic-fascist top-down solutions that always screw up viciously. Schizoanalysis works differently. It avoids Ideas, and sticks to diagrams: networking software for accessing bodies without organs.
Nick Land (Fanged Noumena: Collected Writings, 1987–2007)
My lord?” Nick turned at the tentative, feminine voice, to find two young women standing nearby, watching him eagerly. Nick spoke, wary. “Yes? ” “We—” one of them began to speak, then stopped, uncertain. The other nudged her toward him. “Yes?” “We are fans.” Nick blinked. “Of?” “Of yours.” “Of mine.” “Indeed!” The second girl smiled broadly and stepped closer, holding out what looked suspiciously like— Nick swore under his breath. “Would you be willing to autograph our magazine? ” Nick held up a hand. “I would, girls, but you’ve got the wrong brother.” He pointed to Gabriel. “That is Lord Nicholas.” Rock snorted as the two shifted their attention to the Marquess of Ralston, a dazzlingly handsome copy of their prey, and tittered their excitement. Gabriel instantly eased into his role, turning a brilliant smile on the girls. “I would be happy to autograph your magazine.” He took the journal and the pen they proffered and said, “You know, I must confess, this is the first time I’ve ever drawn the attention of ladies when in the company of my brother. Ralston has always been considered the more handsome of us.” “No!” the girls protested. Nick rolled his eyes. “Indeed. Ask anyone. They’ll tell you it’s the marquess who is the best specimen. Surely you’ve heard that.” He looked up at them with a winning smile. "You can admit it, girls. My feelings shan’t be hurt." Gabriel held up the magazine, displaying the cover, which boasted: Inside! London’s Lords to Land! “Yes … there’s no question that this is going to do wonders for my reputation. I’m so happy to see that it’s getting around that I’m on the hunt for a wife!” The girls nearly expired from delight.
Sarah MacLean (Ten Ways to Be Adored When Landing a Lord (Love By Numbers, #2))
Democracy and ‘progressive democracy’ are synonymous, and indistinguishable from the expansion of the state, Since winning elections is overwhelmingly a matter of vote buying, and society’s informational organs (education and media) are no more resistant to bribery than the electorate, a thrifty politician is simply an incompetent politician, and the democratic variant of Darwinism quickly eliminates such misfits from the gene pool.
Nick Land
Air travel is such a strange experience. It´s such an intimate thing, to travel alongside a stranger for so many hours, to eat together, take in a film, snooze side by side. In economy I think that it´s so intimate, that like neighbours on the same landing, most of us consider that it´s better not to take the risk of ever getting to know them. In business class, there´s just enough room - as elbows don´t actually touch - to take that chance.
Nick Alexander (The Case Of The Missing Boyfriend)
He motions to the glue brush. "Can I have some?" I start to grab it so I can pass it to him. He reaches for it at the same time. Our fingers touch, and the moment they do the fluorescent lights overhead flicker and then fizzle out. Everyone moans, even though we can all still see. There's enough light from the outside filtering in, just not enough for us to really focus on the finer details. Nick's fingers stroke mine lightly, so lightly that I'm almost not sure the touch is real. My insides flicker like the art room lights. They do not, however, fizzle. I turn my head to look him in the eye. He leans over and whispers, "It will be hard to be just your friend." The lights come back on. "Just a little brownout." The art teacher smiles and holds out her arms. "Welcome to Maine, Zara. Land of a million power failures." Nick's breath touches my ear. "I heard you didn't drive to school. I'll bring you home after cross-country,okay?" "Okay," I say, trying to be all calm, but what I really want to do is leap up and do a happy dance all over the art room. Nick is driving me home.
Carrie Jones (Need (Need, #1))
Galaxies are not scarce. There are at least one hundred billion in the universe, with each containing roughly one hundred billion stars. That’s 10,000,000,000,000,000,000,000 – or ten sextillion – stars altogether, perhaps many more. It’s an unintelligible number, and then an awe-striking one – and then a horror story.
Nick Land (Phyl-Undhu: Abstract Horror, Exterminator)
Modernity invented the future, but that’s all over. In the current version ‘progressive history’ camouflages phylogenetic death-drive tactics, Kali-wave: logistically accelerating condensation of virtual species extinction. Welcome to the matricide laboratory. You want it so badly it’s a slow scream in your head, deleting itself into bliss.
Nick Land, Fanged Noumena: Collected Writings, 1987-2007
What is new to modernity is a rate of the obsolescence of truth...
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
I dream of the damnation I have so amply earned, stolen from me by the indolence of God.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
This book was supposed to be finished at Easter, like God.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
It's one of the Filter theories. Absorption into simulations. Cultures swirling out of the universe like dirty water down a plug. Derealization vortices.
Nick Land (Phyl-Undhu: Abstract Horror, Exterminator)
A monster, in comparison, can be no more than a guide -- unless it fuses (like Yog Sothoth) into the enveloping extracosmic fabric, as a super-sentient concentration of doors.
Nick Land (Phyl-Undhu: Abstract Horror, Exterminator)
Nick can do a pretty good nice, but it's not the real deal. His is a thin, watery nice, a niceness-au-jus drizzled over a great big asshole sandwich.
Melissa DeCarlo (The Art of Crash Landing)
Artists; those savage beasts that can't get enough of too much.
Nick Land
Vocabularies are retardation, and grammar, when it is more than a game, is a lie. Language is good only for language games, and among these trust games are the most irredeemably stupid.
Nick Land
I can’t believe they let us name a person,” Nick had said. “It feels like something only the King of the Land should be able to do.” “Or the Queen of the Kingdom,” Alice said. “Oh, they’d never let a woman name a person,” said Nick. “Obviously.
Liane Moriarty (What Alice Forgot)
Nick did not want to go in there now. He felt a reaction against deep wading with the water deepening up under his armpits, to hook big trout in places impossible to land them. In the swamp the banks were bare, the big cedars came together overhead, the sun did not come through, except in patches; in the fast deep water, in the half light, the fishing would be tragic. In the swamp fishing was a tragic adventure. Nick did not want it. He did not want to go down the stream any farther today. He
Ernest Hemingway (Nick Adams Stories)
The history of the United States is a history of settler colonialism—the specific form of colonialism whereby an imperial power seizes Native territory, eliminates the original people by force, and resettles the land with a foreign, invading population.
Nick Estes (Our History Is the Future: Standing Rock Versus the Dakota Access Pipeline, and the Long Tradition of Indigenous Resistance)
Abrahamic tradition under nihilistic direction might not be what anyone wants, but it’s what we have. Accelerating iconoclasm turns the world onto The Nothing. Nietzsche was right to interpret the only global history as this. There is no way out of it because it is itself the ultimate outside.
Nick Land
No one could ever 'be' a libidinal materialist. This is a 'doctrine' that can only be suffered as an abomination, a jangling of the nerves, a combustion of articulate reason, and a nauseating rage of thought. It is a hyperlepsy of the central nervous-system, ruining the body's adaptative reginmes, and consuming its reserves in rhytmic convulsions that are not only futile, but devastating. Schopenhauer already knew that thought is medically disastrous, Nietzsche demonstrated it. An aged philosopher is either a monster of stamina or a charlatan. How long does it take to be wasted by a fire-storm?
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
In Ugandan society a girl who had reached puberty was eligible for a family-arranged marriage. The groom would bring wealth to the bride’s family in the form of cattle, goats, or land. My experience at the hands of Joseph Kony’s murderers and rapists had made a mockery of this custom. I hated the idea, and my father understood.
Nick Hahn (Under the Skin)
America was a land of machines, and it was through machines, the miraculous handmaidens of mob culture, that the muses of illiteracy brought America her voice and vision during the years of the immigrants’ waves. Centuries ago, movable type had given literacy to the common man. Now, through these wondrous newer machines, he would give it back.
Nick Tosches
Nothing is more complex than simplification; what art takes from enigma it more than replenishes in the instantiation of itself, in the labyrinthine puzzle it plants in history. The intensification of enigma. The luxuriantly problematic loam of existence is built out of the sedimented aeons of residues deposited by the will to power, the impulse to create.
Nick Land (Fanged Noumena: Collected Writings, 1987–2007)
In the old days, farmers would keep a little of their home-made opium for their families, to be used during illnesses, or at harvests and weddings; the rest they would sell to the local nobility, or to pykari merchants from Patna. Back then, a few clumps of poppy were enough to provide for a household's needs, leaving a little over, to be sold: no one was inclined to plant more because of all the work it took to grow poppies - fifteen ploughings of the land and every remaining clod to be built; purchases of manure and constant watering; and after all that, the frenzy of the harvest, each bulb having to be individually nicked, drained and scrapped. Such punishment was bearable when you had a patch or two of poppies - but what sane person would want to multiply these labours when there were better, more useful crops to grow, like wheat, dal, vegetables? But those toothsome winter crops were steadily shrinking in acreage: now the factory's appetite for opium seemed never to be seated. Come the cold weather, the English sahibs would allow little else to be planted; their agents would go from home to home, forcing cash advances on the farmers, making them sign /asámi/ contracts. It was impossible to say no to them: if you refused they would leave their silver hidden in your house, or throw it through a window. It was no use telling the white magistrate that you hadn't accepted the money and your thumbprint was forged: he earned commissions on the oppium adn would never let you off. And, at the end of it, your earnings would come to no more than three-and-a-half sicca rupees, just about enough to pay off your advance.
Amitav Ghosh (Sea of Poppies (Ibis Trilogy, #1))
〔〔 〕〕 Shutting-down your identity requires a voyage out to K-space interzone. Zootic affectivity flatlines across a smooth cata-tension plateau and into simulated subversions of the near future, scorched vivid green by alien sex and war. You are drawn into the dripping depths of the net, where dynamic-ice security forces and K-guerillas stalk each other through labyrinthine erogenous zones, tangled in diseased elaborations of desire.
Nick Land
I wiped the blade against my jeans and walked into the bar. It was mid-afternoon, very hot and still. The bar was deserted. I ordered a whisky. The barman looked at the blood and asked: ‘God?’ ‘Yeah.’ ‘S’pose it’s time someone finished that hypocritical little punk, always bragging about his old man’s power…’ He smiled crookedly, insinuatingly, a slight nausea shuddered through me. I replied weakly: ‘It was kind of sick, he didn’t fight back or anything, just kept trying to touch me and shit, like one of those dogs that try to fuck your leg. Something in me snapped, the whingeing had ground me down too low. I really hated that sanctimonious little creep.’ ‘So you snuffed him?’ ‘Yeah, I’ve killed him, knifed the life out of him, once I started I got frenzied, it was an ecstasy, I never knew I could hate so much.’ I felt very calm, slightly light-headed. The whisky tasted good, vaporizing in my throat. We were silent for a few moments. The barman looked at me levelly, the edge of his eyes twitching slightly with anxiety: There’ll be trouble though, don’tcha think?’ ‘I don’t give a shit, the threats are all used up, I just don’t give a shit.’ ‘You know what they say about his old man? Ruthless bastard they say. Cruel…’ ‘I just hope I’ve hurt him, if he even exists.’ ‘Woulden wanna cross him merself,’ he muttered. I wanted to say ‘yeah, well that’s where we differ’, but the energy for it wasn’t there. The fan rotated languidly, casting spidery shadows across the room. We sat in silence a little longer. The barman broke first: ‘So God’s dead?’ ‘If that’s who he was. That fucking kid lied all the time. I just hope it’s true this time.’ The barman worked at one of his teeth with his tongue, uneasily: ‘It’s kindova big crime though, isn’t it? You know how it is, when one of the cops goes down and everything’s dropped ’til they find the guy who did it. I mean, you’re not just breaking a law, your breaking LAW.’ I scraped my finger along my jeans, and suspended it over the bar, so that a thick clot of blood fell down into my whisky, and dissolved. I smiled: ‘Maybe it’s a big crime,’ I mused vaguely ‘but maybe it’s nothing at all…’ ‘…and we have killed him’ writes Nietzsche, but—destituted of community—I crave a little time with him on my own. In perfect communion I lick the dagger foamed with God’s blood.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
Sacrifice is the movement of violent liberation from servility, the collapse of transcendence. Inhibiting the sacrificial relapse of isolated being is the broad utilitarianism inherent to humanity, correlated with a profane delimitation from ferocious nature that finds its formula in theology. In its profane aspect, religion is martialled under a conception of God; the final guarantor of persistent being, the submission of (ruinous) time to reason, and thus the ultimate principle of utility.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
Sacrifice is the movement of violent liberation from servility, the collapse of transcendence. Inhibiting the sacrificial relapse of isolated being is the broad utilitarianism inherent to humanity, correlated with a profane delimitation from ferocious nature that finds its formula in theology. In its profane aspect, religion is martialled under a conception of God; the final guarantor of persistent being, the submission of (ruinous) time to reason, and thus the ultimate principle of utility.
Nick Land (The Thirst for Annihilation: Georges Bataille and Virulent Nihilism (An Essay in Atheistic Religion))
She’s better off without you.” Livingston narrowed his eyes. “I see which way the land lies. If I didn’t trust Miss Hamilton’s superior values and morals—” Nick’s fist snaked out, aiming for the banker’s nose. Livingston barely had time to turn his head before Nick’s knuckles connected with the man’s cheek, sending him stumbling back against the wall. The seascape crashed to the ground. With shock and disbelief in his eyes, Livingston slid to the floor, cradling the rapidly forming red mark on his face. Nick shook his head in disgust. Pity he hadn’t broken the man’s nose.
Debra Holland (Wild Montana Sky (Montana Sky, #1))
One especially prominent time loop lashes together two of the city’s most celebrated high-rises -- the Park Hotel and the Jin Mao Tower -- binding the Puxi of Old Shanghai with the Pudong New Area. Each was the tallest Shanghai building of its age (judged by highest occupied floor), the Park Hotel for five decades, the Jin Mao Tower for just nine years. This discrepancy masks a deeper time-symmetry in the completion dates of the two buildings: the Park Hotel seven years prior to the closing of the city (with the Japanese occupation of the International Settlement in 1941), the Jin Mao Tower seven years after the city’s formal re-opening (as the culmination of Deng Xiaoping’s Southern Tour, in 1992).
Nick Land (Shanghai Times)
From WIP 'Behind The Fan' *** “Come with me.” His warm breath caresses her ear, giving her a delicious tingle. This seduction is no accident. “Baby we can be anywhere; we’ll start a new life. Dottie, all I need is you.” She opens her eyes, he turns when he feels the flutter of her lashes. She expects another plea instead; he kisses her. Soft and slow his lips pulling her down deeper into a sweet chasm. This assault on her proprieties will be slow and subdued. He has after all proven that he is a patient man. Those musicians’ finger will first trail on the column of her neck. The touch is soft but deliberate. Do the top buttons of her blouse come undone on their own accord or has he banished them? She is never sure but before she can register the affect, he lightly strokes the swell of her breast. It is sinful; despite her confessions to the priest regarding this weakness, she is never stronger. Her body willingly betrays her; she will roam her hands down his back, beyond the tapered waist to the hard orbs. She knows that she is no innocent; she revels in his plea for her touch. Convinced that she is going to hell she wished she cared for her soul. “Honey leap with me, we will land safely I promise you.” “Oh God, Nicky you know it is never this simple.” Nick leans back far enough to bore into her eyes; staring to the depth of her soul. She prays he will stay but knows her appeal is futile. He feels colder already, it doesn’t matter how she tries to hold on he is already leaving; leaving her behind. ***
Caroline Walken
From my new WIP, Behind the Fan. “Come with me.” His breath is warm; his lips lightly touch her ear, it gives her a delicious tingle. This seduction is no accident. “Baby we can be anywhere, we will start new. Dottie, all I need is you.” She opens her eyes, he turns when he feels the flutter of her lashes. She expects another plea instead; he kisses her. Soft and slow his lips pulling her down deeper into a sweet chasm. This assault on her proprieties will be slow and subdued. He has after all proven that he is a patient man. Those musicians’ finger will trail on the column of her neck first. The touch is warm, soft nevertheless deliberate. Do the top buttons of her blouse come undone on their own accord or has he banished them? She is never sure but before she can register the affect, he lightly strokes the swell of her breast. It is sinful; no matter how often she confesses her weakness to the priest, she is never stronger. Her body willingly betrays her; she will roam her hands down his back, beyond the tapered waist to the hard orbs of his backside. She herself is no innocent, she revels in his plead for more. She is going to hell she wished she cared for her soul. “Honey leap with me, we will land safely I promise you.” “Oh God, Nicky you know it is never this simple.” Nick leans back enough to look into her eyes; she feels he can see damn near to her soul. She prays he will stay but knows her appeal is futile. He feels colder already, it does not matter how she tries to hold on he is already leaving. Leaving her behind.
Caroline Walken
He stood up, rushed to the fanned-out glossy company brochures. His finger landed on one in the center. Three stylized gold crowns. Corona Labs—BRINGING THE FUTURE TODAY. “This,” he said, finger tapping. Each time he touched the paper it seemed to get warmer. This turned out to be the brochure for a new company. Catherine picked it up, showed it to her husband. “I thought I knew more or less all the research labs in the country, but this is a new one.” Mac turned the glossy paper over in his big hands. There was a videolette loop embedded in the paper, all the rage nowadays. Some smiling woman in a lab coat endlessly raising a test tube in triumph, putting it down, raising it . . . Nick was shaking with tension. The logo, the name Corona Laboratories meant nothing to him, but still they shone in his mind.
Lisa Marie Rice (I Dream of Danger (Ghost Ops, #2))
The critical infrastructure of Indigenous worlds is, fundamentally, about responsibility and being a good relative. But our responsibilities do not happen only in the realm of political transformation. Caretaking, which we address in the introduction and in Part III, is the basis, too, for vibrant economies that must work fluidly with political structures to reinforce the world we seek to build beyond capitalism. We must thus have faith in our own forms of Indigenous political economy, the critical infrastructures that Huson speaks of so eloquently. We must rigorously study, theorize, enact, and experiment with these forms. While it covers ambitious terrain, The Red Deal at its base provides a program for study, theorization, action, and experimentation. But we must do the work. And the cold, hard truth is that we must not only be willing to do the work on a small scale whenever it suits us—in our own lives, in our families, or even in The Red Nation. We must be willing, as our fearless Wet’suwet’en relatives have done, to enforce these orders on a large scale. In conversation, our The Red Nation comrade Nick Estes stated, “I don’t want to just honor the treaties. I want to enforce them.” We can and should implement these programs in our own communities to alleviate suffering and protect what lands we are still able to caretake under colonial rule. To survive extinction, however, we must enforce Indigenous orders in and amongst those who have made it clear they will not stop their plunder until we are all dead. Settler and imperial nations, military superpowers, multinational corporations, and members of the ruling class are enemies of the Earth and the greatest danger to our future. How will we enforce Indigenous political, scientific, and economic orders to successfully prevent our mass ruin? This is the challenge we confront and pose in The Red Deal, and it is the challenge that all who take up The Red Deal must also confront.
The Red Nation (The Red Deal: Indigenous Action to Save Our Earth)
She stared in horror at the pie table. Each of Nick’s hands had landed in a pie. His gray shirt was splattered with crust and whipped cream and berries. Even worse, his face was completely covered. The pie ladies and the other judges rushed to help, trying to right the remaining pies while keeping Nick from dripping berry juice all over the table. At one time Maddie might have done something as impulsive as push Ashby back. But now she took a step away. When she looked at Ashby, she was holding a pie. Actually, she was a second away from launching it. “Just put down the pie and walk away, and we’ll let bygones be bygones.” Maddie felt like she should be wearing a police uniform and holding a stun gun instead of contemplating arming herself with pies. Ashby tossed her a defiant look and cranked up the pie. “Let’s just talk like civilized—” Too late. Ashby tossed the pie, a direct hit to Maddie’s face. The pie splattered all over—her hair, her clothes, blinding her and covering her nose so she couldn’t breathe. This was war. Maddie scooped enough pie off her face so she could see. “Okay, I guess we’re past talking.” Something devilish came over her, that feeling of pure kicking-someone’s-butt that she hadn’t felt since she was nine and Derrick ambushed her Barbies with his GI Joes and held them for ransom money. Maddie picked up a certain pie from the table. One of Ashby’s. It hovered in Maddie’s hands like a Frisbee. Clearing both her pie eyes for good aim, she let it rip. Fluffs of whipped cream spread everywhere, in Ashby’s perfect hair and all over her designer sundress.
Miranda Liasson (Heart and Sole (Kingston Family #1))
Abruptly Nick stood and seized her by the hand. “Come on. We need to go outside. This will work better with show-and-tell.” He trudged through the woods, dragging her behind him. She could feel the tension in his grip. Whatever his secret was, it had him keyed up. The sun had already begun to dip behind the horizon, letting a chill seep into the air. “Keep walking,” he said. “I need some distance from the neighborhood.” “Your secret is in the woods?” said Quinn, shivering. “Dude, if you turn into a werewolf, I am outta here.” He smiled, then stopped and turned to face her. “I’m not a werewolf.” “Vampire? Alien?” She snapped her fingers. “Harry Potter. Or wait, you’d be one of the Weasley twins . . .” “If you could shut up a second, I’d tell you.” “Should I hold your hands? Are we going to phase out and appear in Narnia?” “No.” He glanced around. “If any trees fall, I don’t want them to hit a house.” Trees falling? What? “So you’re secretly Paul Bunyan?” “Quinn.” She shivered again. “What? Seriously, Nick, what’s out here?” “Air.” As he said the word, the breeze kicked up, finding a true wind that ruffled his hair and swirled between them. Leaves shifted and rustled along the ground. Quinn frowned. “Air?” Nick nodded. His expression said that she was missing something important. But . . . air? Air was everywhere. Leaves lifted from the ground and began to spiral around their feet. She started to shiver again—but then the leaves swirled off the ground, forming a moving wall to enclose them. First two feet high, then three, then eye level. Quinn felt the first lick of fear. She moved closer to him— then wondered if that was worse than moving away. “You’re freaking me out a little, Nick. Is the mother ship landing?” “Relax.” He spoke gently, confidently. “It’s just wind.
Brigid Kemmerer (Secret (Elemental, #4))
So I know I am right not to settle, but it doesn't make me feel better as my friends pair off and I stay home on Friday night with a bottle of wine and make myself an extravagant meal and tell myself, This is perfect, as if I'm the one dating me. As I go to endless rounds of parties and bar nights, perfumed and sprayed and hopeful, rotating myself around the room like some dubious dessert. I go on dates with men who are nice and good-looking and smart - perfect-on-paper men who make me feel like I'm in a foreign land, trying to explain myself, trying to make myself known. Because isn't that the point of every relationship: to be known by someone else, to be understood? He gets me. She gets me. Isn't that the simple magic phrase? So you suffer through the night with the perfect-on-paper man - the stutter of jokes misunderstood, the witty remarks lobbed and missed. Or maybe he understands that you've made a witty remark but, unsure of what to do with it, he holds it in his hand like some bit of conversational phlegm he will wipe away later. You spend another hour trying to find each other, to recognise each other, and you drink a little too much and try a little too hard. And you go home to a cold bed and think, That was fine. And your life is a long line of fine. And then you run into Nick Dunne on Seventh Avenue as you're buying diced cantaloupe, and pow, you are known, you are recognised, the both of you. You both find the exact same things worth remembering. (Just one olive, though). You have the same rhythm. Click. You just know each other. All of a sudden you see reading in bed and waffles on Sunday and laughing at nothing and his mouth on yours. And it's so far beyond fine that you know you can never go back to fine. That fast. You think: Oh, here is the rest of my life. It's finally arrived.
Gillian Flynn (Gone Girl)
propose that we consider our farmers on a spectrum, let’s say, of agrarianism. On one end of the spectrum we have farmers like James, interested in producing the finest foodstuffs that they can, given the soil, the climate, the water, the budget, and their talent. They observe how efficacious or not their efforts are proving, and they adapt accordingly. Variety is one of the keys to this technique, eschewing the corporate monocultures for a revolving set of plants and animals, again, to mimic what was already happening on the land before we showed up with our earth-shaving machinery. It’s tough as hell, and in many cases impossible, to farm this way and earn enough profit to keep your bills paid and your family fed, but these farmers do exist. On the other end of the spectrum is full-speed-ahead robo-farming, in which the farmer is following the instructions of the corporation to produce not food but commodities in such a way that the corporation sits poised to make the maximum financial profit. Now, this is the part that has always fascinated me about us as a population: This kind of farmer is doing all they can to make their factory quota for the company, of grain, or meat, or what have you, despite their soil, climate, water, budget, or talent. It only stands to reason that this methodology is the very definition of unsustainable. Clearly, this is an oversimplification of an issue that requires as much of my refrain (nuance!) as any other human endeavor, but the broad strokes are hard to refute. The first farmer is doing their best to work with nature. The second farmer is doing their best despite nature. In order for the second farmer to prosper, they must defeat nature. A great example of this is the factory farming of beef/pork/chicken/eggs/turkey/salmon/etc. The manufacturers of these products have done everything they can to take the process out of nature entirely and hide it in a shed, where every step of the production has been engineered to make a profit; to excel at quantity. I know you’re a little bit ahead of me here, but I’ll go ahead and ask the obvious question: What of quality? If you’re willing to degrade these many lives with impunity—the lives of the animals themselves, the workers “growing” them, the neighbors having to suffer the voluminous poisons being pumped into the ecosystem/watershed, and the humans consuming your products—then what are you about? Can that even be considered farming? Again, I’m asking this of us. Of you and me, because what I have just described is the way a lot of our food is produced right now, in the system that we all support with our dollars. How did we get here, in both the US and the UK? How can we change our national stance toward agriculture to accommodate more middle-size farmers and less factory farms? How would Aldo Leopold feel about it?
Nick Offerman (Where the Deer and the Antelope Play: The Pastoral Observations of One Ignorant American Who Loves to Walk Outside)