Enzyme Quotes

Q: What's the difference between an enzyme and a hormone? A: You can't hear an enzyme.

Anyone who calls it "sexual intercourse" can't possibly be interested in actually doing it. You might as well announce you're ready for lunch by proclaiming, "I'd like to do some masticating and enzyme secreting.

Humans! They lived in a world where the grass continued to be green and the sun rose every day and flowers regularly turned into fruit, and what impressed them? Weeping statues. And wine made out of water! A mere quantum-mechanistic tunnel effect, that'd happen anyway if you were prepared to wait zillions of years. As if the turning of sunlight into wine, by means of vines and grapes and time and enzymes, wasn't a thousand times more impressive and happened all the time...

A poet once said, 'The whole universe is in a glass of wine.' We will probably never know in what sense he meant it, for poets do not write to be understood. But it is true that if we look at a glass of wine closely enough we see the entire universe. There are the things of physics: the twisting liquid which evaporates depending on the wind and weather, the reflection in the glass; and our imagination adds atoms. The glass is a distillation of the earth's rocks, and in its composition we see the secrets of the universe's age, and the evolution of stars. What strange array of chemicals are in the wine? How did they come to be? There are the ferments, the enzymes, the substrates, and the products. There in wine is found the great generalization; all life is fermentation. Nobody can discover the chemistry of wine without discovering, as did Louis Pasteur, the cause of much disease. How vivid is the claret, pressing its existence into the consciousness that watches it! If our small minds, for some convenience, divide this glass of wine, this universe, into parts -- physics, biology, geology, astronomy, psychology, and so on -- remember that nature does not know it! So let us put it all back together, not forgetting ultimately what it is for. Let it give us one more final pleasure; drink it and forget it all!

When certain parts of our bodies are touched, certain enzymes and chemicals that trigger sexual desire are released into our system. The more our bodies are stimulated, the more chemicals are released and the greater our sexual desire grows until it becomes a virtually unstoppable flood.

CHOW^TM contained spun, plaited, and woven protein molecules, capped and coded, carefully designed to be ignored by even the most ravenous digestive tract enzymes; no-cal sweeteners; mineral oils replacing vegetable oils; fibrous materials, colorings, and flavorings. The end result was a foodstuff almost indistinguishable from any other except for two things. Firstly, the price, which was slightly higher, and secondly, the nutritional content, which was roughly equivalent to that of a Sony Walkman.

Who could ever reckon up the damage done to love and friendship and all hopes of happiness by a surfeit or depletion of this or that neurotransmitter? And who will ever find a morality, an ethics down among the enzymes and amino acids when the general taste is for looking in the other direction?

Film is a disease. When it infects your bloodstream, it takes over as the number one hormone; it bosses the enzymes; directs the pineal gland; plays Iago to your psyche. As with heroin, the antidote to film is more film.

Life cannot have had a random beginning ... The trouble is that there are about 2000 enzymes, and the chance of obtaining them all in a random trial is only one part in 10^40,000, an outrageously small probability that could not be faced even if the whole universe consisted of organic soup.

When I started reading the literature of molecular biology, I was stunned by certain descriptions. Admittedly, I was on the lookout for anything unusual, as my investigation had led me to consider that DNA and its cellular machinery truly were an extremely sophisticated technology of cosmic origin. But as I pored over thousands of pages of biological texts, I discovered a world of science fiction that seemed to confirm my hypothesis. Proteins and enzymes were described as 'miniature robots,' ribosomes were 'molecular computers,' cells were 'factories,' DNA itself was a 'text,' a 'program,' a 'language,' or 'data.' One only had to do a literal reading of contemporary biology to reach shattering conclusions; yet most authors display a total lack of astonishment and seem to consider that life is merely 'a normal physiochemical phenomenon.

Sixty percent of the enzymes used in industry are generated by fungi, and fifteen percent of all vaccines are produced by engineered strains of yeast.

Crouched across from her, Toothwort has darkened, his foliate head has ripened into moulde, fungus and brown ripples,sweaty, heavy with rot and enzymes. He smells like natural truth, like sex and death.

The way mycelium produces enzymes to break down complex organic polymers into simpler compounds is a case study for how we can upcycle products and materials in our economy.

Nutritionists don't stop there, because they can't: they have to manufacture complication, to justify the existence of their profession. These new nutritionists have a major commercial problem with the evidence. There's nothing very professional or proprietary about 'Eat your greens,' so they have had to push things further. But unfortunately for them, the technical, confusing, overcomplicated, tinkering interventions that they promote - the enzymes, the exotic berries - are very frequently not supported by convincing evidence.

We now had impressive evidence that low protein intake could markedly decrease enzyme activity and prevent dangerous carcinogen binding to DNA.

Once when I was younger I went out and sat under the sky and looked up and asked it to take me back. What I should have done was gone to the swamp and bog and ask them to bring me back because, if anything is, mud and marsh are the origins of life. Now i think of the storm that made chaos, that the storm opened a door. It tried to make over a world the way it wanted it to be. At school I learned that storms create life, that lightning, with its nitrogen, is a beginning; bacteria and enzymes grow new life from decay out of darkness and water. It's into this that I want to fall, into swamp and mud and sludge and it seems like falling is the natural way of things; gravity needs no fuel, no wings. It needs only stillness and waiting and time.

These are the oldest memories on earth, the time codes carried in every chromosome and gene. Every step we’ve taken in our evolution is a milestone inscribed with organic memories. From the enzymes controlling the carbon-dioxide cycle, to the organization of the brachial plexus and the nerve pathways of the pyramid cells of the mid-brain. Each is a record of a thousand decisions taken in a chemical crisis. Just as psychoanalysis reconstructs the original traumatic situation in order to release the repressed material, so we are now being plunged back into the archaeopsychic past, uncovering the ancient taboos and drives that have been dormant for epochs.

The uniformity of the earth's life, more astonishing than its diversity, is accountable by the high probability that we derived, originally, from some single cell, fertilized in a bolt of lightning as the earth cooled. It is from the progeny of this parent cell that we take our looks; we still share genes around, and the resemblance of the enzymes of grasses to those of whales is a family resemblance.

In other words, the science itself makes clear that hormones, enzymes, and growth factors regulate our fat tissue, just as they do everything else in the human body, and that we do not get fat because we overeat; we get fat because the carbohydrates in our diet make us fat. The science tells us that obesity is ultimately the result of a hormonal imbalance, not a caloric one—specifically, the stimulation of insulin secretion caused by eating easily digestible, carbohydrate-rich foods: refined carbohydrates, including flour and cereal grains, starchy vegetables such as potatoes, and sugars, like sucrose (table sugar) and high-fructose corn syrup. These carbohydrates literally make us fat, and by driving us to accumulate fat, they make us hungrier and they make us sedentary. This is the fundamental reality of why we fatten, and if we’re to get lean and stay lean we’ll have to understand and accept it, and, perhaps more important, our doctors are going to have to understand and acknowledge it, too.

Ehrlich hedged. The cancer cell, he explained, was a fundamentally different target from a bacterial cell. Specific affinity relied, paradoxically, not on “affinity,” but on its opposite—on difference. Ehrlich’s chemicals had successfully targeted bacteria because bacterial enzymes were so radically dissimilar to human enzymes. With cancer, it was the similarity of the cancer cell to the normal human cell that made it nearly impossible to target.

If we are Christ’s, then what befalls us is for His glory and for our good, whether it is caused by enzymes or by enemies.

I shook my head to test for a hangover but it seemed that my alcohol-processing enzymes had done their job adequately.

The term ‘mycorrhiza’ is made from the Greek words for ‘fungus’ and ‘root’. It is itself a collaboration or entanglement; and as such a reminder of how language has its own sunken system of roots and hyphae, through which meaning is shared and traded. The relationship between mycorrhizal fungi and the plants they connect is ancient – around 450 million years old – and largely one of mutualism. In the case of the tree–fungi mutualism, the fungi siphon off carbon that has been produced in the form of glucose by the trees during photosynthesis, by means of chlorophyll that the fungi do not possess. In turn, the trees obtain nutrients such as phosphorus and nitrogen that the fungi have acquired from the soil through which they grow, by means of enzymes that the trees lack.

Alden handed her a bottle of Youth—the special water that elves drank for its unique enzymes. “You must be thirsty.” “Yeah, that happens when someone drugs you.” She was tempted to dump the bottle over his head.

She reaches down into her bulging tote bag and pulls out a small plastic box with a hinged lid. It contains a round pill box with a threaded lid from which she tips out a vitamin pill, a fish-oil pill, and the enzyme tablet that lets her stomach digest milk. Inside the hinged plastic box she also carries packets of salt, pepper, horseradish, and hand-wipes, a doll size bottle of Tabasco sauce, chlorine pills for treating drinking water, Pepto-Bismol chews, and God knows what else. If you go to a concert, Bina has opera glasses. If you need to sit on the grass, she whips out a towel. Ant traps, a corkscrew, candles and matches, a dog muzzle, a penknife, a tiny aerosol can of freon, a magnifying glass - Landsman has seen everything come out of that overstuffed cowhide at one time or another.

Soon after Harris’s HeLa-chicken study, a pair of researchers at New York University discovered that human-mouse hybrids lost their human chromosomes over time, leaving only the mouse chromosomes. This allowed scientists to begin mapping human genes to specific chromosomes by tracking the order in which genetic traits vanished. If a chromosome disappeared and production of a certain enzyme stopped, researchers knew the gene for that enzyme must be on the most recently vanished chromosome. Scientists in laboratories throughout North America and Europe began fusing cells and using them to map genetic traits to specific chromosomes, creating a precursor to the human genome map we have today.

Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).

My childhood superheroes weren’t Marvel characters,’ Merlin once said to me, ‘they were lichens and fungi. Fungi and lichen annihilate our categories of gender. They reshape our ideas of community and cooperation. They screw up our hereditary model of evolutionary descent. They utterly liquidate our notions of time. Lichens can crumble rocks into dust with terrifying acids. Fungi can exude massively powerful enzymes outside their bodies that dissolve soil. They’re the biggest organisms in the world and among the oldest. They’re world-makers and world-breakers. What’s more superhero than that?

They also knew that there was a string of DNA at the end of each chromosome called a telomere, which shortened a tiny bit each time a cell divided, like time ticking off a clock. As normal cells go through life, their telomeres shorten with each division until they’re almost gone. Then they stop dividing and begin to die. This process correlates with the age of a person: the older we are, the shorter our telomeres, and the fewer times our cells have left to divide before they die. By the early nineties, a scientist at Yale had used HeLa to discover that human cancer cells contain an enzyme called telomerase that rebuilds their telomeres. The presence of telomerase meant cells could keep regenerating their telomeres indefinitely. This explained the mechanics of HeLa’s immortality: telomerase constantly rewound the ticking clock at the end of Henrietta’s chromosomes so they never grew old and never died.

Thought is the brain's three milliards Of cells from the inside out. Billions of games of billiards Marked up as Faith and Doubt. My Faith, but their collisions; My logic, but their enzymes; Their pink epinephrin, my visions; Their white epinephrin, my crimes. Since I am the felt arrangement Of ten to the ninth times three, Each atom in its estrangement Must yet be prophetic of me.

Mother trees have an effect on the oceans as well, as Katsuhiko Matsunaga and his team in Japan had confirmed. The leaves, when they fall in the autumn, contain a very large, complex acid called fulvic acid. When the leaves decompose, the fulvic acid dissolves into the moisture of the soil, enabling the acid to pick up iron. This process is called chelation. The heavy, iron-containing fulvic acid is now ready to travel, leaving the home ground of the mother tree and heading for the ocean. In the ocean it drops the iron. Hungry algae, like phytoplankton, eat it, then grow and divide; they need iron to activate a body-building enzyme called nitrogenase. This set of relationships is the feeding foundation of the ocean This is what feeds the fish and keeps the mammals of the sea, like the whale and the otter healthy.

It may be easier to believe that we remain lean because we're virtuous and we get fat because we're not, but the evidence simply says otherwise. Virtue has little more to with our weight than our height. When we grow taller, it's hormones and enzymes that are promoting growth, and we consume more calories than we expend as a result. Growth is the cause - increased appetite and decreased energy expenditure (gluttony and sloth) are the effects. When we grow fatter, the same is true as well. We don't get fat because we overeat; we overeat because were fat.

The room contains a few dozen living human bodies, each one a big sack of guts and fluids so highly compressed that it will squirt for a few yards when pierced. Each one is built around an armature of 206 bones connected to each other by notoriously fault-prone joints that are given to obnoxious creaking, grinding, and popping noises when they are in other than pristine condition. This structure is draped with throbbing steak, inflated with clenching air sacks, and pierced by a Gordian sewer filled with burbling acid and compressed gas and asquirt with vile enzymes and solvents produced by the many dark, gamy nuggets of genetically programmed meat strung along its length. Slugs of dissolving food are forced down this sloppy labyrinth by serialized convulsions, decaying into gas, liquid, and solid matter which must all be regularly vented to the outside world lest the owner go toxic and drop dead. Spherical, gel-packed cameras swivel in mucus-greased ball joints. Infinite phalanxes of cilia beat back invading particles, encapsulate them in goo for later disposal. In each body a centrally located muscle flails away at an eternal, circulating torrent of pressurized gravy. And yet, despite all of this, not one of these bodies makes a single sound at any time during the sultan’s speech.

No, it’s not that. Humans need a … oh, what is it … it’s something with their stomachs. An enzyme, I think. For digesting milk. Only some Humans produce it naturally. But here’s the thing: they’re all so fucking bonkers for cheese that they’ll ingest a dose of the enzymes beforehand so that they can eat it.’ ‘That seems a bit extreme,’ Roveg said. ‘Have you eaten it?’ Tupo asked. ‘Not if my life depended on it,’ Pei said. ‘How is it that their milk makes them sick?’ Speaker said. ‘That’s got to pose a problem if they can’t feed their young.’ ‘Oh, no, I – stars, I forgot the worst part.’ Pei rubbed her neck with her palm. ‘They don’t make cheese with their own milk. They take it from other animals.’ At that, chaos broke out.

A year later, less than 1 percent was gone. “And that’s under the best controlled laboratory conditions. That’s not what you will find in real life,” says Tony Andrady. “Plastics haven’t been around long enough for microbes to develop the enzymes to handle it, so they can only biodegrade the very-low-molecular-weight part of the plastic”—meaning, the smallest, already-broken polymer chains. Although truly biodegradable plastics derived from natural plant sugars have appeared, as well as biodegradable polyester made from bacteria, the chances of them replacing the petroleum-based originals aren’t great.

If you eat a destroying angel, for the rest of the day you’ll feel fine. Later that night, or the next morning, you’ll start exhibiting cholera-like symptoms—vomiting, abdominal pain, and severe diarrhea. Then you start to feel better. At the point where you start to feel better, the damage is probably irreversible. Amanita mushrooms contain amatoxin, which binds to an enzyme that is used to read information from DNA. It hobbles the enzyme, effectively interrupting the process by which cells follow DNA’s instructions. Amatoxin causes irreversible damage to whatever cells it collects in. Since most of your body is made of cells,4 this is bad. Death is generally caused by liver or kidney failure, since those are the first sensitive organs in which the toxin accumulates. Sometimes intensive care and a liver transplant can be enough to save a patient, but a sizable percentage of those who eat Amanita mushrooms die.

Most people think of the mind as located in the head, but the latest findings in physiology suggest that the mind doesn't really dwell in the brain but travels the whole body on caravans of hormones and enzymes, busily making sense of the compound wonders we catalogue as touch, taste, smell, hearing, and vision.

WHY is ocean acidification so dangerous? The question is tough to answer only because the list of reasons is so long. Depending on how tightly organisms are able to regulate their internal chemistry, acidification may affect such basic processes as metabolism, enzyme activity, and protein function. Because it will

Only cells that had been transformed by a virus or a genetic mutation had the potential to become immortal. Scientists knew from studying HeLa that cancer cells could divide indefinitely, and they’d speculated for years about whether cancer was caused by an error in the mechanism that made cells die when they reached their Hayflick Limit. They also knew that there was a string of DNA at the end of each chromosome called a telomere, which shortened a tiny bit each time a cell divided, like time ticking off a clock. As normal cells go through life, their telomeres shorten with each division until they’re almost gone. Then they stop dividing and begin to die. This process correlates with the age of a person: the older we are, the shorter our telomeres, and the fewer times our cells have left to divide before they die. By the early nineties, a scientist at Yale had used HeLa to discover that human cancer cells contain an enzyme called telomerase that rebuilds their telomeres. The presence of telomerase meant cells could keep regenerating their telomeres indefinitely.

ones. They also contain more nutrients and enzymes. If you have to choose one over the other, go for local. You’ll save money, and enjoy more nutrients.   Fruits and vegetables

constructed with the help of specific enzymes. For example, each of the systems involved in the processing of genetic information requires energy at many discrete steps.

He named these “CRISPR-associated,” or Cas, enzymes.

Papaya Enzymes Ease Digestion, Pain, and Inflammation Papaya—along with pineapple—is one of the best sources of digestive enzymes. Papaya contains papain, one of a class of enzymes

a teaspoon of apple cider vinegar in eight ounces of water before meals can also stimulate your enzymes.

some forms of RNA could likewise be enzymes. Specifically, they found that some RNA molecules can split themselves by sparking a chemical reaction. They dubbed these catalytic RNAs “ribozymes,

Glib advice aside, what is the recommendation when it comes to sleep and alcohol? It is hard not to sound puritanical, but the evidence is so strong regarding alcohol’s harmful effects on sleep that to do otherwise would be doing you, and the science, a disservice. Many people enjoy a glass of wine with dinner, even an aperitif thereafter. But it takes your liver and kidneys many hours to degrade and excrete that alcohol, even if you are an individual with fast-acting enzymes for ethanol decomposition. Nightly alcohol will disrupt your sleep, and the annoying advice of abstinence is the best, and most honest, I can offer.

When my world gets reset to zero, my starting post is blood. Specifically, the elements of it, the working compounds that make it what it is. Red cells, white cells, DNA, plasma full of proteins, enzymes, antibodies, minerals, electrolytes—all the things that when poked and prodded right tell you just about everything you want to know about a person. Fascinating stuff, and a little freaky, when you think about it. Blood was where I returned to after the accident that smashed my knee. It was where I went when I got out of prison. It was where I was when Mercy fell into my lap. Now it seemed, blood was my whole reason for being.

of those in food to have optimal health. Most enzymes are destroyed in foods that are processed, refined, or cooked at temperatures above 118 degrees. Raw or lightly steamed foods, on the other hand, are rich in enzymes.

Human breast milk is high in cholesterol because babies need plenty of it to develop healthy brains and sharp eyesight. In fact, breast milk even contains a special enzyme ensuring that babies absorb as much cholesterol as possible.

Our bodies are biologically programmed to react to essential oil constituents, which interact with a variety of receptor sites, neurochemicals and enzymes, giving them a potential for therapeutic activity.” Robert Tisserand   “Essential

This was based on studies of a rare disorder, congenital adrenal hyperplasia (CAH). An enzyme in the adrenal glands has a mutation, and instead of making glucocorticoids, they make testosterone and other androgens, starting during fetal life.

Buchner proposed that fermentation was carried out by biological catalysts that he named enzymes (from the Greek en zyme, meaning in yeast). He concluded that living cells are chemical factories, in which enzymes manufacture the various products.

Two years of Newtrition investment and research had produced CHOW™. CHOW™ contained spun, plaited, and woven protein molecules, capped and coded, carefully designed to be ignored by even the most ravenous digestive tract enzymes; no-cal sweeteners; mineral oils replacing vegetable oils; fibrous materials, colorings, and flavorings. The end result was a foodstuff almost indistinguishable from any other except for two things. Firstly, the price, which was slightly higher, and secondly the nutritional content, which was roughly equivalent to that of a Sony Walkman. It didn’t matter how much you ate, you lost weight.* Fat people had bought it. Thin people who didn’t want to get fat had bought it. CHOW™ was the ultimate diet food—carefully spun, woven, textured, and pounded to imitate anything, from potatoes to venison, although the chicken sold best. Sable sat back and watched the money roll in. He watched CHOW™ gradually fill the ecological niche that used to be filled by the old, untrademarked food. He followed CHOW™ with SNACKS™—junk food made from real junk. MEALS™ was Sable’s latest brainwave. MEALS™ was CHOW™ with added sugar and fat. The theory was that if you ate enough MEALS™ you would a) get very fat, and b) die of malnutrition.

Few scientists acquainted with the chemistry of biological systems at the molecular level can avoid being inspired. Evolution has produced chemical compounds exquisitely organized to accomplish the most complicated and delicate of tasks. Many organic chemists viewing crystal structures of enzyme systems or nucleic acids and knowing the marvels of specificity of the immune systems must dream of designing and synthesizing simpler organic compounds that imitate working features of these naturally occurring compounds.

And it turns out, again and again, that living things seem to have a self-organizing quality. Proteins fold. Enzymes interact. Cells arrange themselves to form organs and the organs arrange themselves to form a coherent individual. Individuals organize themselves to make a population. And populations organize themselves to make a coherent biosphere. From complexity theory, we’re starting to have a sense of how this self-organization may happen, and what it means. And it implies a major change in how we view evolution.

On the voyage from England, beer was their everything. Beer was their fruit and their vegetables in a diet that otherwise consisted of bread, cheese, and meat. Beer was their yogurt with its healing enzymes, and beer was their medicinal spirit. Beer was their water, and beer was their, well, beer.

How do fields express their principles? Physicists use terms like photons, electrons, quarks, quantum wave functions, relativity, and energy conservation. Astronomers use terms like planets, stars, galaxies, Hubble shift, and black holes. Thermodynamicists use terms like entropy, first law, second law, and Carnot cycle. Biologists use terms like phylogeny, ontology, DNA, and enzymes. Each of these terms can be considered to be the thread of a story. The principles of a field are actually a set of interwoven stories about the structure and behavior of field elements, the fabric of the multiverse.

We’d die quite quickly without amino acids, the organic compounds that serve as the building blocks for every protein in the human body. Without them—and in particular the nine essential amino acids that our bodies cannot make on their own—our cells can’t assemble the life-giving enzymes needed for life.

our digestive enzymes are not very good at breaking apart the bond between two prolamins. The result is twofold: first, gluten is known to cross the intestinal barrier, either intact or partly digested; second, gluten (and other prolamins) can disproportionally feed the bacteria in the gut, leading to gut dysbiosis

There were several monitors, all running so fast it was hard to see what they were showing. Wu pushed a button and slowed one image. “Here you see the actual structure of a small fragment of dinosaur DNA,” Wu said. “Notice the sequence is made up of four basic compounds—adenine, thymine, guanine, and cytosine. This amount of DNA probably contains instructions to make a single protein—say, a hormone or an enzyme. The full DNA molecule contains three billion of these bases. If we looked at a screen like this once a second, for eight hours a day, it’d still take more than two years to look at the entire DNA strand. It’s that big.

The human body has a hard time digesting prolamins: our digestive enzymes are not very good at breaking apart the bond between two prolamins. The result is twofold: first, gluten is known to cross the intestinal barrier, either intact or partly digested; second, gluten (and other prolamins) can disproportionally feed the bacteria in the gut, leading to gut dysbiosis

As a thought experiment, von Neumann's analysis was simplicity itself. He was saying that the genetic material of any self-reproducing system, whether natural or artificial, must function very much like a stored program in a computer: on the one hand, it had to serve as live, executable machine code, a kind of algorithm that could be carried out to guide the construction of the system's offspring; on the other hand, it had to serve as passive data, a description that could be duplicated and passed along to the offspring. As a scientific prediction, that same analysis was breathtaking: in 1953, when James Watson and Francis Crick finally determined the molecular structure of DNA, it would fulfill von Neumann's two requirements exactly. As a genetic program, DNA encodes the instructions for making all the enzymes and structural proteins that the cell needs in order to function. And as a repository of genetic data, the DNA double helix unwinds and makes a copy of itself every time the cell divides in two. Nature thus built the dual role of the genetic material into the structure of the DNA molecule itself.

The longevity genes I work on are called “sirtuins,” named after the yeast SIR2 gene, the first one to be discovered. There are seven sirtuins in mammals, SIRT1 to SIRT7, and they are made by almost every cell in the body. When I started my research, sirtuins were barely on the scientific radar. Now this family of genes is at the forefront of medical research and drug development. Descended from gene B in M. superstes, sirtuins are enzymes that remove acetyl tags from histones and other proteins and, by doing so, change the packaging of the DNA, turning genes off and on when needed. These critical epigenetic regulators sit at the very top of cellular control systems, controlling our reproduction and our DNA repair. After a few billion years of advancement since the days of yeast, they have evolved to control our health, our fitness, and our very survival. They have also evolved to require a molecule called nicotinamide adenine dinucleotide, or NAD. As we will see later, the loss of NAD as we age, and the resulting decline in sirtuin activity, is thought to be a primary reason our bodies develop diseases when we are old but not when we are young.

What the poet does is as ordinary and mysterious as digesting. I question. I break life down. I impose chaos on order. For instance, we think we know how food is ingested, digested, divided into energy and excrement. The neat theory, however, is one thing; control of the process is another; consciousness of the process yet another. Are we aware of protein in the stomach being acted on by pepsin, the appropriate enzyme? Digestion, thinking and breathing are all functions we perform without knowing how we perform them. The body is a dark continent. The mind is another. So I can say very little about what I do. I accept nothing as read. I attack the pretence that we know how things work, whether they happen to be the action of saliva or sexual love from adolescence to old age.

Getting calcium from plants might seem a little strange in a society that is so focused on dairy foods as a source of calcium, but some research suggests that even omnivores get as much as 40 percent of their calcium from plant foods. While a strong dairy lobby has convinced many consumers that milk and other dairy foods are essential for a healthy diet, the ability to drink milk into adulthood is not the norm throughout the world. Normal development throughout most of the world involves a gradual loss of the enzyme needed to digest milk sugar after children are weaned from breast milk. We refer to the lack of this enzyme as “lactose intolerance.” But that’s definitely a western bias since this “intolerance” is not a lack or an abnormality; it’s part of normal human development in most people.

Food enzymes are another important dietary element for cultivating vitality. The richer the enzyme content of food (such as raw and fermented foods), the less enzyme power the body must divert for digestive duty, resulting in an overall enhancement of vitality. Eliminating 'enzyme robbers' such as refined sugar and starch, hydrogenated vegetable oils, processed foods, and overcooked meats also boost vitality.

Obsession is a pair of blinders, and Beaumont wore his tightly. He far overstated the role of gastric acid, ignoring the digestive contributions of pepsin and of pancreatic enzymes introduced in the small intestine. As is regularly evidenced by tens of thousands of gastric reflux sufferers—their acid production pharmaceutically curtailed—humans can get by with very little gastric acid. The acid’s main duty, in fact, is to kill bacteria—a fact that never occurred to Beaumont. What, for all his decades of experimenting, did he teach us? That digestion is chemical, not mechanical—but European experimenters, using animals, had shown this to be true two centuries earlier. That protein is easier to digest than vegetable matter. That gastric juices don’t require the “vital forces” of the body. Not, in short, all that much.

Women are sewers just like we are, the once pure boys recognize with a start; it’s raw sewage that produces fertilization; once you understand that you can be fond of yourself and members of the Opposite Sex, but you can never quite see them again as ice cream bars. I, the author, don’t really mind this, for I love all girls and love to hug and kiss them and cheer them up when they cry, and have them perform all the same services for me; and a woman’s saliva is certainly a miracle, think of all those enzymes and germs; and if I took and wrote the chemicals down on a sheet of paper, all COOOHs and sighs, it would look pretty, just like a face all pretty, like the dear round moon-face of her who loves you or the creamy-freckled skin and blue eyes and heavenly hair of that Irish beauty back in college, so don’t think I’m complaining.

A microscopic egg had failed to divide in time due to a failure somewhere along a chain of chemical events, a tiny disturbance in a cascade of protein reactions. A molecular event ballooned like an exploding universe, out onto the wider scale of human misery. No cruelty, nothing avenged, no ghost moving in mysterious ways. Merely a gene transcribed in error, an enzyme recipe skewed, a chemical bond severed. A process of natural wastage as indifferent as it was pointless. Which only brought into relief healthy, perfectly formed life, equally contingent, equally without purpose. Blind luck, to arrive in the world with your properly formed parts in the right place, to be born to parents who were loving, not cruel, or to escape, by geographical or social accident, war or poverty. And therefore to find it so much easier to be virtuous.

Inside the cells of neglected rat pups, enzymes attached chemical tags called methyl groups to their DNA. This mode of inheritance is called epigenetic, since the tags sit on the DNA, and the prefix epi-, from ancient Greek, means “upon.” It differs from the conventional, genetic mode of heredity because the tagged gene still carries the same information, and makes the same protein. But when it’s tagged, it has a hard time doing so.

Certain foods, such as meats, appear to harbor bacteria that can trigger inflammation dead or alive, even when the food is fully cooked. Endotoxins are not destroyed by cooking temperatures, stomach acid, or digestive enzymes, so after a meal of animal products, these endotoxins may end up in your intestines. They are then thought to be ferried by saturated fat across the gut wall into your bloodstream, where they can trigger the inflammatory reaction in your arteries.44

Humans! They lived in a world where the grass continued to be green and the sun rose every day and flowers regularly turned into fruit, and what impressed them? Weeping statues. And wine made out of water! A mere quantum-mechanistic tunnel effect, that’d happen anyway if you were prepared to wait zillions of years. As if the turning of sunlight into wine, by means of vines and grapes and time and enzymes, wasn’t a thousand times more impressive and happened all the time…

These proteins come in many types. Fibrous proteins, for example, form structures such as bones, tissues, muscles, hair, fingernails, tendons, and skin cells. Membrane proteins relay signals within cells. Above all is the most fascinating type of proteins: enzymes. They serve as catalysts. They spark and accelerate and modulate the chemical reactions in all living things. Almost every action that takes place in a cell needs to be catalyzed by an enzyme. Pay attention to enzymes

The Institute had explored the behavior of a great variety of complex systems—corporations in the marketplace, neurons in the human brain, enzyme cascades within a single cell, the group behavior of migratory birds—systems so complex that it had not been possible to study them before the advent of the computer. The research was new, and the findings were surprising. It did not take long before the scientists began to notice that complex systems showed certain common behaviors. They started to think of these behaviors as characteristic of all complex systems. They realized that these behaviors could not be explained by analyzing the components of the systems. The time-honored scientific approach of reductionism—taking the watch apart to see how it worked—didn’t get you anywhere with complex systems, because the interesting behavior seemed to arise from the spontaneous interaction of the components. The behavior wasn’t planned or directed; it just happened. Such behavior was therefore called “self-organizing.

A microscopic egg had failed to divide in time due to a failure somewhere along a chain of chemical events, a tiny disturbance in a cascade of protein reactions. A molecular event ballooned like an exploding universe, out onto the wider scale of human misery. No cruelty, nothing avenged, no ghost moving in mysterious ways. Merely a gene transcribed in error, an enzyme recipe skewed, a chemical bond severed. A process of natural wastage as indifferent as it was pointless. Which only brought into relief healthy,

A major push is under way to figure out the molecular basis of those "critical" or "sensitive" periods, to figure out how the brain changes as certain learning abilities come and go. In some, if not all, of those mammals that have the alternating stripes in the visual cortex known as ocular dominance columns, those columns can be adjusted early in development, but not in adulthood. A juvenile monkey that has one eye covered for an extended period of time can gradually readjust its brain wiring to favor the open eye; an adult monkey cannot adjust its wiring. At the end of a critical period, a set of sticky sugar-protein hybrids known as proteoglycans condenses into a tight net around the dendrites and cell bodies of some of the relevant neurons, and in so doing those proteoglycans appear to impede axons that would otherwise be wriggling around as part of the process of readjusting the ocular dominance columns; no wriggling, no learning. In a 2002 study with rats, Italian neuroscientist Tommaso Pizzorusso and his colleagues dissolved the excess proteoglycans with an antiproteoglycan enzyme known as "chABC," and in so doing managed to reopen the critical period. After the chABC treatment, even adult rats could recalibrate their ocular dominance columns. ChABC probably won't help us learn second languages anytime soon, but its antiproteoglycan function may have important medical implications in the not-too-distant future. Another 2002 study, also with rats, showed that chABC can also promote functional recovery after spinal cord injury.

I was suspicious of such a theory because biology tends to run on hormones and enzymes, that is, control mechanisms, not on mass action (the principle that chemical processes are determined by how much reactants are put into them). The grand principle in biochemistry is that there is hardly anything that is not connected with feedback. If you try to lower your dietary cholesterol, the liver will respond by making more. So simply adding more or less is not guaranteed to give much change at all and I was skeptical if not well-informed.

For an enzyme to be functional, it must fold into a precise three-dimensional shape. How such a complex folding can take place remains a mystery. A small chain of 150 amino acids making up an enzyme has an extraordinary number of possible folding configurations: if it tested 1,012 different configurations every second, it would take about 1,026 years to find the right one. . . . Yet, a denatured enzyme can refold within fractions of a second and then precisely react in a chemical reaction. . . . [I]t demonstrates a stunning complexity and harmony in the universe.21

The brain is provided with a number of enzyme systems which serve to co-ordinate its workings. Some of these enzymes regulate the supply of glucose to the brain cells. Mescalin inhibits the production of these enzymes and thus lowers the amount of glucose available to an organ that is in constant need of sugar. When mescalin reduces the brain’s normal ration of sugar what happens? Too few cases have been observed, and therefore a comprehensive answer cannot yet be given. But what happens to the majority of the few who have taken mescalin under supervision can be summarized as follows…

number of times throughout this book, you’ve come across the terms “delayed stomach-emptying” and “gastroparesis.” As I explained in Chapter 2, elevated blood sugars for prolonged periods can impair the ability of nerves to function properly. It’s very common that the nerves that stimulate the muscular activity, enzyme secretion, and acid production essential to digestion function poorly in long-standing diabetics. These changes affect the stomach, the gut, or both. Dr. Richard McCullum, a noted authority on digestion, has said that if a diabetic has any other form of neuropathy (dry feet, reduced

Zinc Zinc has significant effects on male sexuality, including sperm motility and production, erections, and even testosterone levels. Because the transformation of androstenedione to testosterone depends on a zinc-dependant enzyme, zinc intake significantly affects testosterone levels in the body. One study found that sixty milligrams of zinc daily for fifty days increased serum testosterone levels. Because DHT is metabolized from testosterone, a subsequent rise in DHT levels was also seen. Testosterone and DHT levels only increased in those men whose testosterone levels were low. Normal men experienced no increase.

What is that 95 percent? Some is junk—remnants of pseudogenes inactivated by evolution.fn4,3 But buried in that are the keys to the kingdom, the instruction manual for when to transcribe particular genes, the on/off switches for gene transcription. A gene doesn’t “decide” when to be photocopied into RNA, to generate its protein. Instead, before the start of the stretch of DNA coding for that gene is a short stretch called a promoterfn5—the “on” switch. What turns the promoter switch on? Something called a transcription factor (TF) binds to the promoter. This causes the recruitment of enzymes that transcribe the gene into RNA. Meanwhile, other transcription factors deactivate genes.

We have phosphate on our DNA. Aluminum attaches itself to it and messes up our genetic coding process. While the aluminum is inside a cell, some of its particles attach to adenosine triphosphate (ATP). The ATP is in charge of our cell’s energy production. So, in this manner the aluminum can affect our energy level. We have enzymes (proteins) within our cells that depend on attaching themselves to calcium (Ca) or magnesium (Mg) to function properly. Once our enzymes have attached to the Ca and Mg, they can carry on with their functions. Because the aluminum has such a strong positive charge, it’s able to break the bond between our enzymes and Ca or Mg. These enzymes are now no longer attached to Ca or Mg. They have become neutralized and are unable to carry out their responsibilities. We need these enzymes for efficient metabolism, but now the aluminum is attached to the enzymes instead. The protein molecules all look a little different because their shape reflects what they are designed to do. Aluminum disturbs their individual tasks and clumps them together so they are now misshapen and no longer functioning. Aluminum also messes with the cell surface, the membrane, the outer layer of the cell. With a dysfunctional cell membrane, everything inside the cell becomes compromised and it is no longer able to properly communicate with the environment surrounding the cell about what needs to be done[96].

For example, all three partners cooperate to make nutrients. To create the amino acid phenylalanine, they need nine enzymes. Tremblaya can build 1,2,5,6,7, and 8; Moranella can make 3,4, and 5; and the mealybug alone makes the 9th. Neither mealybug nor the two bacteria can make phenylalanine on their own; they depend on each other to fill the gaps in their repertoires. This reminds me of the Graeae of Greek mythology: the three sisters who share one ee and one tooth between them. Anything more would be redundant: their arrangement, though odd, still allows them to see and chew. So it is with the mealybug and its symbionts. They ended up with a single metabolic network, distributed between their three complementary genomes. In the arithmetic of symbionts, one plus one plus one can equal one.

Our Meat Facial today, Ms. Loeffler?” “Uhm, how’s that.” “You didn’t get our offer in the mail? on special all this week, works miracles for the complexion—freshly killed, of course, before those enzymes’ve had a chance to break down, how about it?” “Well, I don’t . . .” “Wonderful! Morris, kill . . . the chicken!” From the back room comes horrible panicked squawking, then silence. Maxine meantime is tilted back, eyelids aflutter, when— “Now we’ll just apply some of this,” wham! “. . . meat here, directly onto this lovely yet depleted face . . .” “Mmff . . .” “Pardon? (Easy, Morris!)” “Why is it . . . uh, moving around like that? Wait! is that a— are you guys putting a real dead chicken in my— aaahhh!” “Not quite dead yet!” Morris jovially informs the thrashing Maxine as blood and feathers fly everywhere. Each

The third cardinal feature of gene regulation, Monod and Jacob discovered, was that every gene had specific regulatory DNA sequences appended to it that acted like recognition tags. Once a sugar sensing-protein had detected sugar in the environment, it would recognize one such tag and turn the target genes on or off. That was a gene's signal to make more RNA messages and thereby generate the relevant enzyme to digest the sugar. A gene, in short, possessed not just information to encode a protein, but also information about when and where to make that protein. All that data was encrypted in DNA, typically appended to the front of every gene (although regulatory sequences) an also be appended to the ends and middle of genes). The combination of regulatory sequences and the protein-encoding sequence defined a gene.

Sourdough isn't only for bread. Any grain-based baked good- from crackers to waffles, from muffins to pasta, can be made with a wild yeast starter. Why would the home baker want to incorporate sourdough into their regular baking? First, it's an excellent way to use the starter you remove during feedings. Instead of throwing the excess in the trash, add it to your pancake batter or chocolate chip cookies. Second, a sourdough starter is an ecosystem of wild yeasts and beneficial bacteria that work together to add B-vitamins to grains, to break down gluten for better digestion, and to neutralize phytic acid and enzyme inhibitors. In other words, it's good for you. And finally, because sourdough eventually becomes a way of life. Experimenting with different ways of using it is one of the most satisfying aspects of using wild yeast in your kitchen.

To reap curcumin’s maximum longevity benefits, take it in supplement form. Pair it with bromelain (a digestive enzyme found in pineapple), or take it in an oil-based capsule to increase your body’s ability to absorb and utilize curcumin. Do not fall for the mistake of using black pepper or bioperine to increase absorption. Black pepper extract absolutely does raise your levels of turmeric and many other polyphenols. The only problem is that it does it by interfering with cytochrome P450 3A4 liver detox, which you need to stay young. That liver pathway cleans out pollutants, and by messing with that detox pathway, black pepper extract prevents your body from clearing potentially harmful compounds. So you end up with higher levels of turmeric and higher levels of aging toxins, too. This is not a good strategy. Black pepper extract has also been linked to leaky gut syndrome,53 so I strongly recommend skipping it.

Let’s say we are making bread dough. We add a bit of yeast to the flour to make the bread rise. The yeast causes many tiny air pockets to form, which is what makes bread different from, say, a shingle. Now, as you eat the baked bread, your stomach acid and digestive enzymes enter those air pockets and rapidly break the molecules of flour into individual sugar molecules that then pass from your digestive tract into your bloodstream. Even whole wheat bread, with shreds of fiber remaining, is easy pickings for digestive enzymes—they have no difficulty entering the air pockets and digesting the starch in the bread. Pasta is different. It is not made with yeast, so it has no air pockets. If bread is like a pile of tiny twigs, ready to ignite with a single spark, pasta is like a cord of logs—it is much more compacted and “catches fire” more slowly. Even if you chew pasta thoroughly, there is no way it can digest as rapidly as bread—and that’s why it has a lower GI.

For years, exercise scientists have been convinced that the only way to increase mitochondrial density is with aerobic endurance training, but recent studies have proved otherwise. Not only is an increase in the size and number of mitochondria a proven adaptation to HIIT, but the mitochondrial benefit of HIIT goes way beyond size and number. For example, all your mitochondria contain oxidative enzymes, such as citrate synthase, malate dehydrogenase, and succinate dehydrogenase. These oxidative enzymes lead to improved metabolic function of your skeletal muscles—particularly by causing more effective fat and carbohydrate breakdown for fuel and also by accelerating energy formation from ATP. So more oxidative enzymes means that you have a higher capacity for going longer and harder. And it turns out that, according to an initial study on the effect of HIIT on oxidative enzymes, there were enormous increases in skeletal muscle oxidative enzymes in seven weeks in subjects who did four to ten thirty-second maximal cycling sprints followed by four minutes of recovery just three days a week. But what about HIIT as opposed to aerobic cardio? Another six-week training study compared the increase in oxidative enzymes that resulted from either: 1. Four to six thirty-second maximal-effort cycling sprints, each followed by four-and-a-half minutes of recovery, performed three days a week (classic HIIT training) or 2. Forty to sixty minutes of steady cycling at 65 percent VO2 max (an easy aerobic intensity) five days a week The levels of oxidative enzymes in the mitochondria in subjects who performed the HIIT program were significantly higher—even though they were training at a fraction of the volume of the aerobic group. How could this favorable endurance adaptation happen with such short periods of exercise? It turns out that the increased mitochondrial density and oxidative-enzyme activity from HIIT are caused by completely different message-signaling pathways than those created by traditional endurance training.

Enzymes have made and unmade every single biomolecule inside every living cell that lives or has ever lived. Enzymes are as close as anything to the vital factors of life. So the discovery that some, and possibly all, enzymes work by promoting the dematerialization of particles from one point in space and their instantaneous materialization in another provides us with a novel insight into the mystery of life. And while there remain many unresolved issues related to enzymes that need to be better understood, such as the role of protein motions, there is no doubt that quantum tunneling plays a role in the way they work. Even so, we should address a criticism made by many scientists who accept the findings of Klinman, Scrutton and others, but nevertheless claim that quantum effects have as relevant a role in biology as they have in the workings of a steam train: they are always there but are largely irrelevant to understanding how either system works. Their argument is often positioned within a debate about whether or not enzymes evolved to take advantage of quantum phenomena such as tunneling. The

breast hair growth hips bums enlargement yodi pills and botsho creams for sale in UK, USA, Canada, UAE, call/whatsup +27737105667 For those hoping to grow their hair longer, faster, biotin has served as a vitamin supplement used in the quest for maximized hair growth. Biotin is a B-complex vitamin that can be found in both supplement and food form. Biotin deficiencies are associated with hair loss. Biotin is vital to cell proliferation, which is why it is a valuable tool in hair growth. When ingested, biotin reacts with cell enzymes and plays a vital part in producing amino acids, which are the building blocks of protein. Hair itself consists of keratin, which is a form of protein. Therefore, consuming foods that contain biotin helps to contribute to hair growth. However, many people are missing one or even all of these lifestyle factors that make hair grow at its best rate. Because biotin helps hair reach its full potential in terms of growth, taking a supplement to meet the daily recommended dosage helps a person maximize her hair's fastest growth potential. for more information please N.B email orders and consultation are accepted make an order now by calling call/whatsup +27737105667

In network models of the interactome, these truncating mutations can be thought of as the removal of one node along with all its edges - a node removal. Nonconservative missense mutations of amino acids in the protein core that lead to major folding problems, protein aggregation, and premature protein degradation can also be modeled as node removals. At the other end of the mutational spectrum are small in-frame indels or missense mutations. These can preserve protein folding, but may modify the active site of an enzyme or affect the binding to another protein or macromolecule. In network models, these mutations, which specifically perturb a single molecular interaction, have been labeled as edge-specific or "edgetic". While investigation of the precise interaction defects associated with point mutations is of course not new, the term edgetic promotes a subtle yet meaningful archetype shift from conventional gene-centered models, which emphasize consideration of which specific edges are affected by a mutation, complement and extend classic gene-centric models, which ascertain only whether a gene product is present or not present and neglect less overt alterations of a given gene or gene product.

Second, the production of RNA Messages was coordinately regulated. When the sugar source was switched to lactose, the bacteria turned on an entire module of genes-several lactose-metabolizing genes-to digest lactose. One of the genes in the module specified a "transporter protein" that allowed lactose to enter the bacterial cell. Another gene encoded an enzyme that was needed to break down lactose into parts. Yet another specified an enzyme to break those chemical parts into subparts. Surprisingly, all the genes dedicated to a particular metabolic pathway were physically present next to each other on the bacterial chromosome-like library books stacked by subject-and they were induced simultaneously in cells. The metabolic alteration produced a profound genetic alteration in a cell. It wasn't just a cutlery switch; the whole dinner service was altered in a single swoop. A functional circuit of genes was switched on and off, as if operated by a common spool or a master switch. Monod called one such gene module an operon. The genesis of proteins was thus perfectly synchronized with the requirements of the environment: supply the correct sugar, and a set of sugar-metabolizing genes would be turned on together.

are out of balance, your life quality diminishes substantially. The hormones estrogen, progesterone, and testosterone make us men and women. Every woman and man has different hormonal requirements. That’s why there is no “one pill fits all” solution. Your hormonal requirements are unique. What you need is different from what I need. This is what hormones “do”; now you might be wondering what they are made of—what they are exactly? A hormone is a chemical substance produced in your body by your glands. They are a complex combination of chemical keys that turn important metabolic locks in our cells, tissues, and organs. All the approximately sixty to ninety trillion cells in our bodies are influenced to some degree by these amazing hormonal keys. The turning on of these “locks” stimulates activity within the cells of our brain, intestines, muscles, genital organs, and skin. As such, hormones determine the rate at which our cells burn up nutrients and other food substances, release energy, and determine whether our cells should produce milk, hair, secretions, enzymes, or some other metabolic (life) product. Hormones affect virtually every function in your body. They affect your mood, how you cope, your sexuality, your sex drive. We all have hormones and without them

Ocean Acidification is sometimes referred to as Global Warming's Equally Evil Twin. The irony is intentional and fair enough as far as it goes... No single mechanism explains all the mass extinctions in the record and yet changes in ocean chemistry seem to be a pretty good predictor. Ocean Acidification played a role in at least 2 of the Big Five Extinctions: the End-Permian and the End-Triassic. And quite possibly it was a major factor in a third, the End-Cretaceous. ...Why is ocean acidification so dangerous? The question is tough to answer only because the list of reasons is so long. Depending on how tightly organisms are able to regulate their internal chemistry, acidification may affect such basic processes as metabolism, enzyme activity, and protein function. Because it will change the makeup of microbial communities, it will alter the availability of key nutrients, like iron and nitrogen. For similar reasons, it will change the amount of light that passes through the water, and for somewhat different reasons, it will alter the way sound propagates. (In general, acidification is expected to make the seas noisier.) It seems likely to promote the growth of toxic algae. It will impact photosynthesis—many plant species are apt to benefit from elevated CO2 levels—and it will alter the compounds formed by dissolved metals, in some cases in ways that could be poisonous. Of the myriad possible impacts, probably the most significant involves the group of creatures known as calcifiers. (The term calcifier applies to any organism that builds a shell or external skeleton or, in the case of plants, a kind of internal scaffolding out of the mineral calcium carbonate.)... Ocean acidification increases the cost of calcification by reducing the number of carbonate ions available to organisms that build shells or exoskeletons. Imagine trying to build a house while someone keeps stealing your bricks. The more acidified the water, the greater the energy that’s required to complete the necessary steps. At a certain point, the water becomes positively corrosive, and solid calcium carbonate begins to dissolve. This is why the limpets that wander too close to the vents at Castello Aragonese end up with holes in their shells. According to geologists who work in the area, the vents have been spewing carbon dioxide for at least several hundred years, maybe longer. Any mussel or barnacle or keel worm that can adapt to lower pH in a time frame of centuries presumably already would have done so. “You give them generations on generations to survive in these conditions, and yet they’re not there,” Hall-Spencer observed.

Every Sunday he arrived in his wine-dark Buick, a tall, prune-faced, sad-seeming man with an incongruously vital head of wavy hair. He was not interested in children. A proponent of the Great Books series—which he had read twice—Uncle Pete was engaged with serious thought and Italian opera. He had a passion, in history, for Edward Gibbon, and, in literature, for the journals of Madame de Staël. He liked to quote that witty lady’s opinion on the German language, which held that German wasn’t good for conversation because you had to wait to the end of the sentence for the verb, and so couldn’t interrupt. Uncle Pete had wanted to become a doctor, but the “catastrophe” had ended that dream. In the United States, he’d put himself through two years of chiropractic school, and now ran a small office in Birmingham with a human skeleton he was still paying for in installments. In those days, chiropractors had a somewhat dubious reputation. People didn’t come to Uncle Pete to free up their kundalini. He cracked necks, straightened spines, and made custom arch supports out of foam rubber. Still, he was the closest thing to a doctor we had in the house on those Sunday afternoons. As a young man he’d had half his stomach surgically removed, and now after dinner always drank a Pepsi-Cola to help digest his meal. The soft drink had been named for the digestive enzyme pepsin, he sagely told us, and so was suited to the task.

Working independently, Baltimore and Temin discovered an enzyme found in retroviruses that could build DNA from an RNA template. They called the enzyme reverse transcriptase-"reverse" because it inverted the normal direction of information flow: from RNA back to DNA, or from a gene's message backward to a gene, thereby violating Crick's "central dogma" (that genetic information only moved from genes to messages, but never backward). Using reverse transcriptase, ever RNA in a cell could be used as a template to build its corresponding gene. A biologist could thus generate a catalog, or "library" of all "active" genes in a cell-akin to a library of books grouped by subject. There would be a library of genes for T cells and another for red blood cells, a library for neurons in the retina, for insulin-secreting cells of the pancreas, and so forth. By comparing libraries derived from two cells-a T cell and a pancreas cell, say-an immunologist could fish out genes that were active in one cell and not the other (e.g., insulin or the T cell receptor). Once identified, that gene could be amplified a millionfold in bacteria. The gene could be isolated and sequenced, its RNA and protein sequence determined, its regulatory regions identified; it could be mutated an inserted into a different cell to decipher the gene's structure and function. In 1984 this technique was deployed to clone the T cell receptor-a landmark achievement in immunology.

-jeez, these guys, with their on-again, off-again rela­tionships, lutgen said; -Yeah, Dave said: now you see them, now you see them once more; -They're virtual insects!, Jurgen said; -Virtually innumerable, said Dave; -I wonder, though, if we haven't got it wrong, Jurgen said: I mean, I wonder if maybe these guys' natural condition isn't to be lit up-if their ground state isn't actually when they're glowing; -Hm, said Dave: so what they're actually doing is turning off their lights­ -Right: momentarily going under; -Flashing darkness­ -Projecting their inner voids­ -Their repeating, periodic depressions ... -So then, I suppose, we should really call them douse bugs---;. -Exactly... -Or nature's faders---;. -Flying extinguishers­ -Buzzing snuffers-! -Or maybe­ -Or maybe, despite what it looks like, maybe they really are glowing constantly, Jurgen said: but, through some malign unknown mechanism, their everlasting light is peri­odically swallowed up by un-understood atmospheric forces; -So then they're being occluded­ -Rudely occluded­ -Denied their God-given right to shine ... -So that, I suppose, would make them-o horror-victims­ -Yeah: victims of predatory darkness­ -Of uncontrollable flares of night; -So it isn't bioluminescence, but eco-eclipsis­ -Exactly: ambient effacement­ -Nature's station-identification­ -Ongoing lessons in humility ... -In fact, that might explain the nits' efficiency factor, Jurgen Said: you know, these guys burn so cleanly that they produce what's known in the trade as cold light they put together this real slow oxidation reaction within these little cell-structures called photocytes, using a really weird enzyme and substrate that're, like, named for the devil; and the result is virtually 100% efficient: almost no heat is lost at all... -So, in fact, these folks should be our heroes­ -Exactly: our role models­ -Our ego ideals---;. -Hosts of syndicated talk shows­ -Spokes-things for massive advertising campaigns---;. -In fact, children should be forced to leave their families and go be raised by them­-MacArthur winners, all...

SUPPLEMENT DAILY DOSAGE Vitamin A 10,000 IU or 6 mg beta-carotene (choose mixed carotenes if available)     B-complex vitamins B1, B2, B3, B5: 50 mg B6: 50 mg, or 100 mg if nauseated (can be higher: if necessary up to 250 mg to prevent nausea) B12: 400 mcg Choline, Inositol, PABA: 25 mg Biotin: 200 mcg Folic acid: 500 mcg (increase this to 1000 mcg if you have suffered a previous miscarriage, if there is a history of neural tube defects in your family, or if you are over 40 years of age)     Vitamin C 1–2 g (take the higher dose if you are exposed to toxicity or in contact with, or suffering from, infection)     Bioflavonoids 500–1000 mg (helpful for preventing miscarriage and breakthrough bleeding)     Vitamin D 200 IU     Vitamin E 500 IU (increasing to 800 IU during last trimester)     Calcium 800 mg (increasing to 1200 mg during middle trimester when your baby’s bones are forming, or if symptoms such as leg cramps indicate an increased need)     Magnesium 400 mg (half the dose of calcium)     Potassium 15 mg or as cell salt (potassium chloride, 3 tablets)     Iron Supplement only if need is proven; dosage depends on serum ferritin levels (stored iron) If levels < 30 mcg per litre, take 30 mg If levels < 45 mcg per litre, take 20 mg If levels < 60 mcg per litre, take 10 mg This test for ferritin levels should be repeated at the end of each trimester, and we give further details in Chapter 11.     Manganese 10 mg     Zinc 20–60 mg, taken last thing at night on an empty stomach (dose level to depend on results of zinc taste test, which ideally should be performed at two monthly intervals during your pregnancy; see page 172–174 for details)     Chromium 100–200 mcg (upper limit applies to those with sugar cravings or with proven need)     Selenium 100–200 mcg (upper limit for those exposed to high levels of heavy metal or chemical pollution). Selenium is best taken away from vitamin C, but can be taken with zinc.     Iodine 75 mcg (or take 150 mg of kelp instead)     Acidophilus/Bifidus Half to one teaspoonful, one to three times daily (upper limits for those who suffer from thrush)     Evening primrose oil 500–1000 mg two to three times daily     MaxEPA (or deep sea fish oils) 500–1000 mg two to three times daily     Garlic 2000–5000 mg (higher levels for those exposed to toxins)     Silica 20 mg     Copper 1–2 mg (but only if zinc levels are adequate)     Hydrochloric acid and digestive enzymes For those with digestive problems. There are numerous proprietary preparations which contain an appropriate combination of active ingredients. Ask your health practitioner, pharmacist or health food shop for guidance, and take as directed on the label.     Co-enzyme Q10 10 mg daily