Computer Hacking Quotes

Artemis felt like he was six again and caught hacking the school computers trying to make the test questions harder

Look, Sage. I don't know much about chemistry or computer hacking or photosynthery, but this is something I've got a lot of experience with." I think he mean photosynthesis, but I didn't correct him. "Use my knowledge. Don't let it go to waste.

How did you find me? If you hacked into the Club’s computer to look up my appointments - " “Whoa, I think you overestimate me, shitlord. Last time I checked all I did was be in the wrong place at the right time. I saw you and had to - ” “Stalk me.” “ - delicately approach you. In a sideways manner. From behind. Without being seen at all. For ten minutes.

Adrian looked over at me again. “Who knows more about male weakness: you or me?” “Go on.” I refused to directly answer the question. “Get a new dress. One that shows a lot of skin. Short. Strapless. Maybe a push-up bra too.” He actually had the audacity to do a quick assessment of my chest. “Eh, maybe not. But definitely some high heels.” “Adrian,” I exclaimed. “You’ve seen how Alchemists dress. Do you think I can really wear something like that?” He was unconcerned. “You’ll make it work. You’ll change clothes or something. But I’m telling you, if you want to get a guy to do something that might be difficult, then the best way is to distract him so that he can’t devote his full brainpower to the consequences.” “You don’t have a lot of faith in your own gender.” “Hey, I’m telling you the truth. I’ve been distracted by sexy dresses a lot.” I didn’t really know if that was a valid argument, seeing as Adrian was distracted by a lot of things. Fondue. T-shirts. Kittens. “And so, what then? I show some skin, and the world is mine?” “That’ll help.” Amazingly, I could tell he was dead serious. “And you’ve gotta act confident the whole time, like it’s already a done deal. Then make sure when you’re actually asking for what you want that you tell him you’d be ‘so, so grateful.’ But don’t elaborate. His imagination will do half the work for you. ” I shook my head, glad we’d almost reached our destination. I didn’t know how much more I could listen to. “This is the most ridiculous advice I’ve ever heard. It’s also kind of sexist too, but I can’t decide who it offends more, men or women.” “Look, Sage. I don’t know much about chemistry or computer hacking or photosynthery, but this is something I’ve got a lot of experience with.” I think he meant photosynthesis, but I didn’t correct him. “Use my knowledge. Don’t let it go to waste.

live close to nature and you'll never feel lonely. Don't drive those sparrows out of your veranda; they won't hack into your computer.

Welcome to the future, Holmesy. It’s not about hacking computers anymore; it’s about hacking human souls.

You’ve obviously hacked into my computer. How did you do it?” “I came in your backdoor.” “I’m certain you did not.” “I assure you that I did.” “Without even discussing it with me first? No preparation? No warning? Don’t you think that’s incredibly bad form?” Ian grinned. “Are we still talking about your computer? Because I find you utterly delightful right now.

Get out of my computer immediately. I’m willing to move past the fact that you hacked me, but it ends now.” “No more backdoor?” “No more backdoor.” He appeared crestfallen. “Ever?” “Never,” Kate said firmly. “Not even on my birthday or like a special occasion?” “Are we still talking about my computer?” she asked. “You probably are.

Opponents past and present have the same essential weakness about them: first they want to use you, then they want to be you, then they want to snuff you out.

We don’t put up with having our computers hacked for the benefit of others, so why cede control of our minds and our very being to anyone else?

Remember, when you connect with another computer, you're connecting to every computer that computer has connected to.

Computer hacking was like a chemical bond holding us all together.

Attribution is an enduring problem when it comes to forensic investigations. Computer attacks can be launched from anywhere in the world and routed through multiple hijacked machines or proxy servers to hide evidence of their source. Unless a hacker is sloppy about hiding his tracks, it's often not possible to unmask the perpetrator through digital evidence alone.

It’s not about hacking computers anymore; it’s about hacking human souls.

the Hacker Ethic, which instructs you to keep working until your hack tops previous efforts.

Hacking isn't just native to computing — it exists wherever rules do.

he thought a bit about God, and whether He might be some kind of universal digital computer, subject to the occasional bug or hack. Was it possible that politicians and hedge-fund operators were some kind of garbled cosmic computer code? That the Opponent, instead of having horns and a forked tail, was a fat bearded guy drinking Big Gulps and eating anchovy pizzas and writing viruses down in a hellish basement? That prayers weren’t answered because Satan was running denial-of-service attacks?

The only way to maintain privacy on the internet is to not be on the internet.

hacking in its pure form stretched back centuries. It wasn't restricted to a single medium. It was more than a methodology. It was an ethos.

Never post family pictures online, There's no such thing as privacy settings. It is a total jungle out there, In every corner predators are lurking.

Biological knowledge multiplied by Computing power multiplied by Data equals Ability to Hack Humans.

b × c × d = ahh! Biological knowledge multiplied by Computing power multiplied by Data equals Ability to Hack Humans.

If the AI has (perhaps for safety reasons) been confined to an isolated computer, it may use its social manipulation superpower to persuade the gatekeepers to let it gain access to an Internet port. Alternatively, the AI might use its hacking superpower to escape its confinement.

Hmmm? Oh, I hacked her onboard computer. Not a very advanced machine, unfortunately. I was hoping to discover another AI, so we could complain about organics together. Wouldn't that have been a fun time?' 'Fun time!' Doomslug said from where she'd climbed up onto the armrest of my seat. I slipped into my cockpit. 'You really did that?' I asked. 'Complaining about organics? Yes, it's very easy.

All the computers in the world are on a network. They’re linked by our cuffs. But I’m a computer. Jack’s a computer—Akilah—PA Young—all the cy-clones. We’re all computers. You know the great thing about computers? They can be hacked.

Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).

... there was one new metallic monstrosity stacked in one corner that she hadn’t seen the last time she was a visitor to his strange chamber, it appeared to be a mass of hard drives all fused together, but they looked too sophisticated to be merely hard drives. “What on earth is that?” “That’s my Kung Fu,” he said proudly, patting the top of the futuristic-looking stack. “Is that what you wanted to show me?” “No, but it’s impressive, isn’t it?” “If you say so.” Steves sighed and shook his head, so few people could appreciate the intellectual complexity of an almost untraceable hacking device.

A primary concern among Mac users, and a benefit to the hacking community, is the Mac owner mind-set that Macs aren’t susceptible to viruses or attack. It is an interesting stance considering that the thing they are claiming to be naturally impervious from attack is, well, a computer!

Not your smartphone, not your computer, and not your bank account – they are in a race to hack you and your organic operating system. You might have heard that we are living in the era of hacking computers, but that’s hardly half the truth. In fact, we are living in the era of hacking humans.

Women, on the other hand, had to wield their intellects like a scythe, hacking away against the stubborn underbrush of low expectations. A woman who worked in the central computing pools was one step removed from the research, and the engineers’ assignments sometimes lacked the context to give the computer much knowledge about the afterlife of the numbers that bedeviled her days. She might spend weeks calculating a pressure distribution without knowing what kind of plane was being tested or whether the analysis that depended on her math had resulted in significant conclusions. The work of most of the women, like that of the Friden, Marchant, or Monroe computing machines they used, was anonymous. Even a woman who had worked closely with an engineer on the content of a research report was rarely rewarded by seeing her name alongside his on the final publication. Why would the computers have the same desire for recognition that they did? many engineers figured. They were women, after all. As

Harper’s brow furrowed. “Why are you even asking me questions? I know you did your research on me.” “I did,” he admitted unrepentantly. “I learned a lot about you. For instance, I learned that you’re responsible for the breakdown of an ex-boyfriend’s bank account—” “Allegedly.” “—that you hacked a human police database and messed up their filing system when your friend was unjustly arrested—” “Hearsay.” “—that you beat up a male demon who hurt your cousin—” “I have an alibi for that.” “—and that you infected an old teacher’s computer with a virus that caused clips of gay porn to pop up on his screen every thirty seconds.” “Closet gays do the strangest things when the pressure gets too much.

b×c×d = ahh! Biological knowledge multiplied by Computing power multiplied by Data equals Ability to Hack Humans.

Grades are just entered into a computer like everything else is entered into a computer. Computers can be hacked.

To put it succinctly, we can use the following formula: b×c×d = ahh! Biological knowledge multiplied by Computing power multiplied by Data equals Ability to Hack Humans.

It is common knowledge in the programmer's circle that almost every smartphone in the world is infected with some form of trojan.

Anything that says ‘smart’ in front of its name, is a potential magnet for trojans. The same goes for anything that is endorsed as ‘open source’.

Internet privacy is fiction.

In our online world there is no way for a regular civilian to keep their phone uninfected. And that includes everybody except skilled and resourceful programmers.

Darkness envelopes technology where only a select few gain access to the light switch.

Shvatio sam… Da nema čoveka, kompjuter ne bi postojao. Da nema kompjutera, mnogi ljudi ne bi naučili šta znači biti čovek.

No technology that's connected to the internet is unhackable.

End-to-End encryption is practically a meaningless phrase used by internet-based companies to coax people into believing the modern myth of online privacy.

He told me that if I was not out of the apartment by the thirtieth of August he would hack me. “I am extremely smart and talented with computers,” he wrote.

Watney entered the hack earlier today, and we confirmed it worked. We updated Pathfinder’s OS without any problems. We sent the rover patch, which Pathfinder rebroadcast. Once Watney executes the patch and reboots the rover, we should get a connection.” “Jesus, what a complicated process,” Venkat said. “Try updating a Linux server sometime,” Jack said. After a moment of silence, Tim said, “You know he was telling a joke, right? That was supposed to be funny.” “Oh,” said Venkat. “I’m a physics guy, not a computer guy.” “He’s not funny to computer guys, either.

People are hard to be understand, full of lies, full of corupt, if you want a friendship with them is like to have a friendship with nothing. But nothing isn't a possibility of the ability, people you can go 40....50 years studying them and what you will find is that you are old and they are new and more and more stupid. I find somebody who can I trust, it's my computer who else??? It's too clever, I need to hang out with clever people not with idiots!

Hackers are unruly. That is the essence of hacking. And it is also the essence of Americanness. It is no accident that Silicon Valley is in America, and not France, or Germany, or England, or Japan. In those countries, people color inside the lines.

Quote may seem a bit of a foreign concept, because few other languages have anything like it. It's closely tied to one of the most distinctive features of Lisp: code and data are made out of the same data structures, and the quote operator is the way we distinguish between them.

Corporate secrets bouncing around a computer system thats open to the world? Hey, that’s fair game and they deserve the embarrassment of its discovery. But using this knowledge to line your pockets or, worse, using insider knowledge to get the information and then calling that hacking is an affront to any of us who hack for the sake of learning.

I'm proud of it. Apart from marking the first occasion when I used my talent on behalf of other people without being asked and without caring whether I was rewarded--which was a major breakthrough in itself--the job was a pure masterpiece. Working on it, I realized in my guts how an artist or an author can get high on the creative act. The poker who wrote Precipice's original tapeworm was pretty good, but you could theoretically have killed it without shutting down the net--that is, at the cost of losing thirty or forty billion bits of data. Which I gather they were just about prepared to do when I showed up. But mine...Ho, no! That, I cross my heart, cannot be killed without DISMANTLING the net.

Coca-Cola, Amazon, Baidu, and the government are all racing to hack you. Not your smartphone, not your computer, and not your bank account; they are in a race to hack you and your organic operating system. You might have heard that we are living in the era of hacking computers, but that’s not even half the truth. In fact, we are living in the era of hacking humans.

If you're anything like me, you don't make up your mind about important issues by doing original research, pounding over primary sources and coming to your own conclusions; you listen to people who claim to know what they're talking about - "experts" - and try to determine which of them is more credible. You do your best to gauge who's authentically well-informed and unbiased, who has an agenda and what it is - who's a corporate flack, a partisan hack, or a wacko. I believe that global warming is real and anthropogenic not because I've personally studied Antarctic ice core samples or run my own computer climate models, but because all the people who support the theory are climatologists with no evident investment in the issue, and all the people who dismiss it as alarmist claptrap are shills of the petro-chemical industry or just seem to like debunking things, from the Holocaust to the moon landing. We put our trust - our votes, our money, sometimes our lives - in someone else's authority. In other words, most of us decide not what to believe but whom to believe. And I say believe because for most people, such decisions are matters of faith rather than reason.

Most Americans are unaware that Iran’s military has such robust computer-hacking capabilities, but Mobasheri had been one of the leaders of this all-but-unheralded success of the Islamic Republic. He and his team of hackers had broken into American defense networks, and had placed infiltration-agent programs into U.S. wireless companies that had taken years and tens of millions of dollars to clean out.

Pham Nuwen spent years learning to program/explore. Programming went back to the beginning of time. It was a little like the midden out back of his father’s castle. Where the creek had worn that away, ten meters down, there were the crumpled hulks of machines—flying machines, the peasants said—from the great days of Canberra’s original colonial era. But the castle midden was clean and fresh compared to what lay within the Reprise’s local net. There were programs here that had been written five thousand years ago, before Humankind ever left Earth. The wonder of it—the horror of it, Sura said—was that unlike the useless wrecks of Canberra’s past, these programs still worked! And via a million million circuitous threads of inheritance, many of the oldest programs still ran in the bowels of the Qeng Ho system. Take the Traders’ method of timekeeping. The frame corrections were incredibly complex—and down at the very bottom of it was a little program that ran a counter. Second by second, the Qeng Ho counted from the instant that a human had first set foot on Old Earth’s moon. But if you looked at it still more closely. . .the starting instant was actually some hundred million seconds later, the 0-second of one of Humankind’s first computer operating systems. So behind all the top-level interfaces was layer under layer of support. Some of that software had been designed for wildly different situations. Every so often, the inconsistencies caused fatal accidents. Despite the romance of spaceflight, the most common accidents were simply caused by ancient, misused programs finally getting their revenge. “We should rewrite it all,” said Pham. “It’s been done,” said Sura, not looking up. She was preparing to go off-Watch, and had spent the last four days trying to root a problem out of the coldsleep automation. “It’s been tried,” corrected Bret, just back from the freezers. “But even the top levels of fleet system code are enormous. You and a thousand of your friends would have to work for a century or so to reproduce it.” Trinli grinned evilly. “And guess what—even if you did, by the time you finished, you’d have your own set of inconsistencies. And you still wouldn’t be consistent with all the applications that might be needed now and then.” Sura gave up on her debugging for the moment. “The word for all this is ‘mature programming environment.’ Basically, when hardware performance has been pushed to its final limit, and programmers have had several centuries to code, you reach a point where there is far more signicant code than can be rationalized. The best you can do is understand the overall layering, and know how to search for the oddball tool that may come in handy—take the situation I have here.” She waved at the dependency chart she had been working on. “We are low on working fluid for the coffins. Like a million other things, there was none for sale on dear old Canberra. Well, the obvious thing is to move the coffins near the aft hull, and cool by direct radiation. We don’t have the proper equipment to support this—so lately, I’ve been doing my share of archeology. It seems that five hundred years ago, a similar thing happened after an in-system war at Torma. They hacked together a temperature maintenance package that is precisely what we need.” “Almost precisely.

Chloe's fingers flew over her keyboard. I raised an eyebrow at Hunter. "Is she Googling hunter-assholes? I doubt they have their own Web page." Chloe snorted. "You'd be surprised." "She's hacking the school files," Hunter said. "She does it all the time." "Don't they have security for that kind of thing?" Chloe snorted again. "Please." I knew that tone. Connor used it whenever someone called his computer mojo into question.

While human hacking does not occur via computer code, there are many ways to tinker with the human brain. Certainly drugs can do the tampering. How about cleverly disguised messages, disinformation, propaganda, and the newest method of tampering, fake news? Can these messages act like phishing? And what if one of these messages gains hold? Can these alter your brain? Or how about something as innocuous as food? All of the above.

Gates was, after all, a serial stealer of computer time, and he had manipulated passwords to hack into accounts from eighth grade through his sophomore year at Harvard. Indeed, when he claimed in his letter that he and Allen had used more than $40,000 worth of computer time to make BASIC, he omitted the fact that he had never actually paid for that time and that much of it was on Harvard’s military-supplied computer, funded by American taxpayers.

The word “hacker” has two very different meanings. The people I knew who called themselves hackers were software wizards who managed to creatively program themselves out of tight corners. They knew all the nooks and crannies of the operating system. Not dull software engineers who put in forty hours a week, but creative programmers who can’t leave the computer until the machine’s satisfied. A hacker identifies with the computer, knowing it like a friend.

The hecklers weren’t hacking people’s computers; they were hacking their minds, in two ways. In one sense, they sought to change a target audience’s perception on issues, nudging audiences toward preferred foreign policy positions and influencing experts, politicians, and media personalities toward a pro-Assad or pro-Russia stance. When not shaping audience conversations through a barrage of slanted content and supporting banter, hecklers sought to batter adversaries off social media platforms through either endless harassment or compromise.

Watt settled in, finding his rhythm, his fingers flying across the touch screen as he manipulated pieces of invisible information, like pulling on the strings of a massive, intricate net. He and Nadia worked well together. Even as he made his way slowly and methodically through the hack, Watt could feel her there, a ghostly presence, like the light of a candle flickering just at the edge of his vision. He lost all sense of time and place, his entire being reduced to the string of numerics on the screen before him, waiting for the flash of intuition that would enable him to see a pattern, a blind spot, anything at all.

Security is a big and serious deal, but it’s also largely a solved problem. That’s why the average person is quite willing to do their banking online and why nobody is afraid of entering their credit card number on Amazon. At 37signals, we’ve devised a simple security checklist all employees must follow: 1. All computers must use hard drive encryption, like the built-in FileVault feature in Apple’s OS X operating system. This ensures that a lost laptop is merely an inconvenience and an insurance claim, not a company-wide emergency and a scramble to change passwords and worry about what documents might be leaked. 2. Disable automatic login, require a password when waking from sleep, and set the computer to automatically lock after ten inactive minutes. 3. Turn on encryption for all sites you visit, especially critical services like Gmail. These days all sites use something called HTTPS or SSL. Look for the little lock icon in front of the Internet address. (We forced all 37signals products onto SSL a few years back to help with this.) 4. Make sure all smartphones and tablets use lock codes and can be wiped remotely. On the iPhone, you can do this through the “Find iPhone” application. This rule is easily forgotten as we tend to think of these tools as something for the home, but inevitably you’ll check your work email or log into Basecamp using your tablet. A smartphone or tablet needs to be treated with as much respect as your laptop. 5. Use a unique, generated, long-form password for each site you visit, kept by password-managing software, such as 1Password.§ We’re sorry to say, “secretmonkey” is not going to fool anyone. And even if you manage to remember UM6vDjwidQE9C28Z, it’s no good if it’s used on every site and one of them is hacked. (It happens all the time!) 6. Turn on two-factor authentication when using Gmail, so you can’t log in without having access to your cell phone for a login code (this means that someone who gets hold of your login and password also needs to get hold of your phone to login). And keep in mind: if your email security fails, all other online services will fail too, since an intruder can use the “password reset” from any other site to have a new password sent to the email account they now have access to. Creating security protocols and algorithms is the computer equivalent of rocket science, but taking advantage of them isn’t. Take the time to learn the basics and they’ll cease being scary voodoo that you can’t trust. These days, security for your devices is just simple good sense, like putting on your seat belt.

Using an example of how this would work in a more relatable scenario. If you were to imagine a hacker accessing the computer system of your bank and transferring all your funds from your own account into his and deleting all evidence of the transaction, existing technology would not be able to pick this up and you would likely be out of pocket. In the case of a blockchain currency like Bitcoin, having one server hacked with a false transaction being inserted into the database would not be consistent with the same record across the other copies of the database. The blockchain would identify the transaction as being illegitimate and would ultimately reject it meaning the money in your account would be kept safe.

Code for Humanity (The Sonnet) There is no such thing as ethical hacking, If it were ethical they wouldn't be teaching it. Because like it or not ethics is bad for business, They teach hacking so they could use it for profit. With the right sequence of zeros and ones we could, Equalize all bank accounts of planet earth tomorrow. Forget about what glass house gargoyles do with tech, How will you the human use tech to eliminate sorrow? In a world full of greedy edisons, be a humble Tesla, Time remembers no oligarch kindly no matter the status. Only innovators who get engraved in people's heart, Are the ones who innovate with a humane purpose. Innovate to bridge the gap, not exploit and cater to disparities. In a world run by algorithms of greed write a code that helps 'n heals.

On July 13, 2018, a federal grand jury in the District of Columbia returned an indictment charging Russian military intelligence officers from the GRU with conspiring to hack into various U.S. computers used by the Clinton Campaign, DNC, DCCC, and other U.S. persons, in violation of 18 U.S.C. §§ 1030 and 371 (Count One); committing identity theft and conspiring to commit money laundering in furtherance of that hacking conspiracy, in violation of 18 U.S.C. §§ 1028A and 1956(h) (Counts Two through Ten); and a separate conspiracy to hack into the computers of U.S. persons and entities responsible for the administration of the 2016 U.S. election, in violation of 18 U.S.C. §§ 1030 and 371 (Count Eleven). Netyksho Indictment.1277 As of this writing, all 12 defendants remain at large.

In the longer term, by bringing together enough data and enough computing power, the data giants could hack the deepest secrets of life, and then use this knowledge not just to make choices for us or manipulate us but also to reengineer organic life and create inorganic life-forms. Selling advertisements may be necessary to sustain the giants in the short term, but tech companies often evaluate apps, products, and other companies according to the data they harvest rather than according to the money they generate. A popular app may lack a business model and may even lose money in the short term, but as long as it sucks data, it could be worth billions.4 Even if you don’t know how to cash in on the data today, it is worth having it because it might hold the key to controlling and shaping life in the future. I don’t know for certain that the data giants explicitly think about this in such terms, but their actions indicate that they value the accumulation of data in terms beyond those of mere dollars and cents. Ordinary humans will find it very difficult to resist this process. At present, people are happy to give away their most valuable asset—their personal data—in exchange for free email services and funny cat videos. It’s a bit like African and Native American tribes who unwittingly sold entire countries to European imperialists in exchange for colorful beads and cheap trinkets. If, later on, ordinary people decide to try to block the flow of data, they might find it increasingly difficult, especially as they might come to rely on the network for all their decisions, and even for their healthcare and physical survival.

Best hacking books Cell phone hacking books Cell phone hacking sites Certified ethical hacking Computer hacking Computer hacking 101 Computer hacking books Computer hacking device Computer hacking equipment Computer hacking for dummies Computer hacking forensic investigator Computer hacking forensic investigator certification Computer hacking laws Computer hacking programs Computer hacking software Computer hacking tools Ethical hacking Ethical hacking and countermeasures Ethical hacking and countermeasures 2010 Ethical hacking and countermeasures attack phases Ethical hacking and countermeasures Linux Macintosh and mobile systems Ethical hacking and countermeasures secure network infrastructures Ethical hacking and countermeasures threats and defense mechanisms Ethical hacking and countermeasures web applications and data servers Ethical hacking and network defense Ethical hacking and pentesting Ethical hacking and pentesting guide Ethical hacking books Ethical hacking certification Ethical hacking course Ethical hacking kindle Ethical hacking tools Facebook hacking sites Facebook hacking software Facebook hacking tools Free computer hacking software Free Facebook hacking sites Free hacking software Hacking Hacking electronics Hacking electronics stuff Hacking electronics torrent Hacking electronics video Hacking exposed Hacking exposed 7 Hacking exposed 8 Hacking exposed book Hacking exposed computer forensics Hacking exposed Linux Hacking exposed mobile Hacking exposed network security secrets & solutions Hacking exposed PDF Hacking exposed windows Hacking exposed wireless Hacking sites Hacking software Hacking software computer Hacking software for iPhone Hacking tools Hacking tools and techniques Hacking your education torrent How to hacking sites Online Facebook hacking sites Password hacking software What is ethical hacking?

So which theory did Lagos believe in? The relativist or the universalist?" "He did not seem to think there was much of a difference. In the end, they are both somewhat mystical. Lagos believed that both schools of thought had essentially arrived at the same place by different lines of reasoning." "But it seems to me there is a key difference," Hiro says. "The universalists think that we are determined by the prepatterned structure of our brains -- the pathways in the cortex. The relativists don't believe that we have any limits." "Lagos modified the strict Chomskyan theory by supposing that learning a language is like blowing code into PROMs -- an analogy that I cannot interpret." "The analogy is clear. PROMs are Programmable Read-Only Memory chips," Hiro says. "When they come from the factory, they have no content. Once and only once, you can place information into those chips and then freeze it -- the information, the software, becomes frozen into the chip -- it transmutes into hardware. After you have blown the code into the PROMs, you can read it out, but you can't write to them anymore. So Lagos was trying to say that the newborn human brain has no structure -- as the relativists would have it -- and that as the child learns a language, the developing brain structures itself accordingly, the language gets 'blown into the hardware and becomes a permanent part of the brain's deep structure -- as the universalists would have it." "Yes. This was his interpretation." "Okay. So when he talked about Enki being a real person with magical powers, what he meant was that Enki somehow understood the connection between language and the brain, knew how to manipulate it. The same way that a hacker, knowing the secrets of a computer system, can write code to control it -- digital namshubs?" "Lagos said that Enki had the ability to ascend into the universe of language and see it before his eyes. Much as humans go into the Metaverse. That gave him power to create nam-shubs. And nam-shubs had the power to alter the functioning of the brain and of the body." "Why isn't anyone doing this kind of thing nowadays? Why aren't there any namshubs in English?" "Not all languages are the same, as Steiner points out. Some languages are better at metaphor than others. Hebrew, Aramaic, Greek, and Chinese lend themselves to word play and have achieved a lasting grip on reality: Palestine had Qiryat Sefer, the 'City of the Letter,' and Syria had Byblos, the 'Town of the Book.' By contrast other civilizations seem 'speechless' or at least, as may have been the case in Egypt, not entirely cognizant of the creative and transformational powers of language. Lagos believed that Sumerian was an extraordinarily powerful language -- at least it was in Sumer five thousand years ago." "A language that lent itself to Enki's neurolinguistic hacking." "Early linguists, as well as the Kabbalists, believed in a fictional language called the tongue of Eden, the language of Adam. It enabled all men to understand each other, to communicate without misunderstanding. It was the language of the Logos, the moment when God created the world by speaking a word. In the tongue of Eden, naming a thing was the same as creating it. To quote Steiner again, 'Our speech interposes itself between apprehension and truth like a dusty pane or warped mirror. The tongue of Eden was like a flawless glass; a light of total understanding streamed through it. Thus Babel was a second Fall.' And Isaac the Blind, an early Kabbalist, said that, to quote Gershom Scholem's translation, 'The speech of men is connected with divine speech and all language whether heavenly or human derives from one source: the Divine Name.' The practical Kabbalists, the sorcerers, bore the title Ba'al Shem, meaning 'master of the divine name.'" "The machine language of the world," Hiro says.

Kyle worked in technology; he knew it would only be a matter of time before the video of Daniela and the A-list actor went viral and spread everywhere. So he did what any pissed-off, red-blooded computer geek would do after catching his girlfriend giving an underwater blowjob to another man: he hacked into Twitter and deleted both the video and her earlier tweet from the site. Then, raging at the world that had devolved so much in civility that 140-character breakups had become acceptable, he shut down the entire network in a denial-of-service attack that lasted two days. And so began the Great Twitter Outage of 2011. The Earth nearly stopped on its axis. Panic and mayhem ensued as Twitter unsuccessfully attempted to counteract what it deemed the most sophisticated hijacking they’d ever experienced. Meanwhile, the FBI waited for either a ransom demand or political statement from the so-called “Twitter Terrorist.” But neither was forthcoming, as the Twitter Terrorist had no political agenda, already was worth millions, and had most inconveniently taken off to Tijuana, Mexico to get shit-faced drunk on cheap tequila being served by an eight-fingered bartender named Esteban.

As biotechnology and machine learning improve, it will become easier to manipulate people's deepest emotions and desires, and it will become more dangerous than ever to just follow your heart. When Coca-Cola, Amazon, Baidu or the government knows how to pull the strings of your heart and press the buttons of your brain, could you still tell the difference between your self and their marketing experts? To succeed in such a daunting task, you will need to work very hard on getting to know your operating system better. To know what you are, and what you want from life. This is, of course, the oldest advice in the book: know thyself. For thousands of years philosophers and prophets have urged people to know themselves. But this advice was never more urgent than in the twenty-first century, because unlike in the days of Laozi or Socrates, now you have serious competition. Coca-Cola, Amazon, Baidu and the government are all racing to hack you. Not your smartphone, not your computer, and not your bank account - they are in a race to hack you and your organic operating system. You might have heard that we are living in the era of hacking computers, but that's hardly half the truth. In fact, we are living in the era of hacking humans.

He pokes his katana through the side of the cube and follows it through the wall and out the other side. This is a hack. It is really based on a very old hack, a loophole that he found years ago when he was trying to graft the sword-fighting rules onto the existing Metaverse software. His blade doesn't have the power to cut a hole in the wall -- this would mean permanently changing the shape of someone else's building -- but it does have the power to penetrate things. Avatars do not have that power. That is the whole purpose of a wall in the Metaverse; it is a structure that does not allow avatars to penetrate it. But like anything else in the Metaverse, this rule is nothing but a protocol, a convention that different computers agree to follow. In theory, it cannot be ignored. But in practice, it depends upon the ability of different computers to swap information very precisely, at high speed, and at just the right times. And when you are connected to the system over a satellite uplink, as Hiro is, out here on the Raft, there is a delay as the signals bounce up to the satellite and back down. That delay can be taken advantage of, if you move quickly and don't look back. Hiro passes right through the wall on the tail end of his all-penetrating katana.

Easy Plans Of FIFA Mobile Hack Simplified Typically the most popular game on earth is football. Now individuals can enjoy their as an online game. FIFA Mobile online game was created so that football enthusiasts and football games can play with online. The online game FIFA Mobile is as tough as the actual football game. While playing FIFA Mobile no matter how skilled one is in other online games, he can have a difficult time. It is so tough that some people get stuck at a certain stage of the game. FIFA Mobile coin generator can be used by them if folks desire to make the game simpler. Among the numerous games, FIFA Mobile is one of the most famous games among players of various ages. Nevertheless, users should collect lots of coins to be able to get players of their choice. And getting the coins is definitely not simple whatsoever. For FIFA Mobile, Cheats in such a situation can be of great use. The program is offered by several websites at no cost as mentioned before. Users are just needed to find the perfect site to download the cheats. Once players have their teams or once they choose real life players, they have been great to go players can win distinct sort of rewards when they score goals or overcome opposite teams the benefits are in the form of coins or points users can attempt to accumulate as many coins as they can but if it is not that potential to collect the coins, they could simply use the FIFA Mobile Soccer Hack mentioned previously. The help can come in the form of FIFA Mobile Cheats. It may be said that cheats can be quite useful in games anytime. They can help users in gathering things and also help in winning games or crossing periods that are difficult. There are now plenty of cheats available online. There are various sources from where one can learn more about the FIFA Mobile coin generator software. One must see a reliable site. Because cost will be different in different sites it's also very vital to find the cost of the coin generator software out. It will not take time to install the coin generator software in the computer.

Key Points: ● Transparency - Blockchain offers significant improvements in transparency compared to existing record keeping and ledgers for many industries. ● Removal of Intermediaries – Blockchain-based systems allow for the removal of intermediaries involved in the record keeping and transfer of assets. ● Decentralization – Blockchain-based systems can run on a decentralized network of computers, reducing the risk of hacking, server downtime and loss of data. ● Trust – Blockchain-based systems increase trust between parties involved in a transaction through improved transparency and decentralized networks along with removal of third-party intermediaries in countries where trust in the intermediaries doesn’t exist. ● Security – Data entered on the blockchain is immutable, preventing against fraud through manipulating transactions and the history of data. Transactions entered on the blockchain provide a clear trail to the very start of the blockchain allowing any transaction to be easily investigated and audited. ● Wide range of uses - Almost anything of value can be recorded on the blockchain and there are many companies and industries already developing blockchain-based systems. These examples are covered later in the book. ● Easily accessible technology – Along with the wide range of uses, blockchain technology makes it easy to create applications without significant investment in infrastructure with recent innovations like the Ethereum platform. Decentralized apps, smart contracts and the Ethereum platform are covered later in the book. ● Reduced costs – Blockchain-based ledgers allow for removal of intermediaries and layers of confirmation involved in transactions. Transactions that may take multiple individual ledgers, could be settled on one shared ledger, reducing the costs of validating, confirming and auditing each transaction across multiple organizations. ● Increased transaction speed – The removal of intermediaries and settlement on distributed ledgers, allows for dramatically increased transaction speeds compared to a wide range of existing systems.

told my people that I wanted only the best, whatever it took, wherever they came from, whatever it cost. We assembled thirty people, the brightest cybersecurity minds we have. A few are on loan, pursuant to strict confidentiality agreements, from the private sector—software companies, telecommunications giants, cybersecurity firms, military contractors. Two are former hackers themselves, one of them currently serving a thirteen-year sentence in a federal penitentiary. Most are from various agencies of the federal government—Homeland Security, CIA, FBI, NSA. Half our team is devoted to threat mitigation—how to limit the damage to our systems and infrastructure after the virus hits. But right now, I’m concerned with the other half, the threat-response team that Devin and Casey are running. They’re devoted to stopping the virus, something they’ve been unable to do for the last two weeks. “Good morning, Mr. President,” says Devin Wittmer. He comes from NSA. After graduating from Berkeley, he started designing cyberdefense software for clients like Apple before the NSA recruited him away. He has developed federal cybersecurity assessment tools to help industries and governments understand their preparedness against cyberattacks. When the major health-care systems in France were hit with a ransomware virus three years ago, we lent them Devin, who was able to locate and disable it. Nobody in America, I’ve been assured, is better at finding holes in cyberdefense systems or at plugging them. “Mr. President,” says Casey Alvarez. Casey is the daughter of Mexican immigrants who settled in Arizona to start a family and built up a fleet of grocery stores in the Southwest along the way. Casey showed no interest in the business, taking quickly to computers and wanting to join law enforcement. When she was a grad student at Penn, she got turned down for a position at the Department of Justice. So Casey got on her computer and managed to do what state and federal authorities had been unable to do for years—she hacked into an underground child-pornography website and disclosed the identities of all the website’s patrons, basically gift-wrapping a federal prosecution for Justice and shutting down an operation that was believed to be the largest purveyor of kiddie porn in the country. DOJ hired her on the spot, and she stayed there until she went to work for the CIA. She’s been most recently deployed in the Middle East with US Central Command, where she intercepts, decodes, and disrupts cybercommunications among terrorist groups. I’ve been assured that these two are, by far, the best we have. And they are about to meet the person who, so far, has been better. There is a hint of reverence in their expressions as I introduce them to Augie. The Sons of Jihad is the all-star team of cyberterrorists, mythical figures in that world. But I sense some competitive fire, too, which will be a good thing.

During 2015 hackers repeatedly breached U.S. government computer systems. Not just the State Department, which seemed to be constantly ejecting unwanted intruders, but the Pentagon and the White House as well. Derek and I joked about how her private email probably was more secure than a State Department system, which we knew would have been hacked.

Buterin and those involved with The DAO and Ethereum immediately began to address the hack. The situation was problematic, however, because Ethereum was a decentralized world computer that provided the platform for dApps to run on. However, it did not promise to audit and endorse each application.

Ronan Byrne, an electrical engineering student in Dublin, Ireland, enjoyed watching Netflix, but he also knew that he should exercise more often than he did. Putting his engineering skills to use, Byrne hacked his stationary bike and connected it to his laptop and television.20 Then he wrote a computer program that would allow Netflix to run only if he was cycling at a certain speed. If he slowed down for too long, whatever show he was watching would pause until he started pedaling again. He was, in the words of one fan, “eliminating obesity one Netflix binge at a time.

NSA “hunts” system administrators who control computer networks and servers, then targets their private email and Facebook accounts to gather information useful for hacking into their computers and gaining access to the entire network of computers they control.

I’m a consultant, advocate, and expert witness for people who are being targeted by covert crimes.  The types of crimes that my clients suffer include: being stalked and harassed by groups of people, workplace mobbing, public mobbing, illegal entry into their homes and vehicles, extreme slander, computer and phone hacking, bugging of their homes, phones, etc., constant surveillance, vandalism, biological/chemical assaults, and remote weapons’ assaults.

These operations move memory around, perform some sort of basic math, or interrupt the processor to get it to do something else. In the end, that's all a computer processor can really do. But in the same way millions of books have been written using a relatively small alphabet of letters, an infinite number of possible programs can be created using a relatively small collection of machine instructions.

My brief exposure to hacking communities left a permanent impression. You learn that no system is absolutely –nothing is impenetrable and barriers are a dare. The hacker philosophy taught me that if you shift your perspective on any system: a computer, a network, even society, you may discover flaws and vulnerabilities.

I stipulate that this does not make sense,” Randy says. Eb glares into the distance, not mollified. “Will you agree with me that the world is full of irrational people, and crazy situations?” “Jaaaa—” Eb says guardedly. “If you and I are going to hack and get paid for it, people have to hire us, right?” Eb considers it carefully. “Yes.” “That means dealing with those people, at some level, unpleasant as it may be. And accepting a whole lot of other nonsense, like lawyers and PR people and marketroids. And if you or I tried to deal with them, we would go out of our minds. True?” “Most likely, yes.” “It is good, then, that people like Avi and Beryl have come into existence, because they are our interface.” An image from the Cold War comes into Randy’s head. He reaches out with both hands and gropes in the air. “Like those glove boxes that they use to handle plutonium. See?” Eberhard nods. An encouraging sign. “But that doesn’t mean that it’s going to be like programming computers. They can only filter and soften the irrational nature of the world beyond, so Avi and Beryl may still do things that seem a little crazy.” Eb has been getting a more and more faraway look in his eyes.

Hacking human biology Quantum mechanics has the ability to provide us with more knowledge about human biology beyond better disease detection and highly targeted, needle-free therapies. Australian scientists have recently discovered a way to investigate a living cell's inner workings using a new method of laser microscopy based on the concepts of quantum mechanics. And we can use quantum computers to sequence DNA quickly then solve other health-care challenges with Big Data. This opens the possibility of specialized treatment, based on the unique genetic structure of people.

Supposedly they could do that, Vleen reminded himself with a healthy measure of skepticism. The target ship was controlled by humans who had an Elder AI helping them. He thought it unlikely that ship’s original AI still existed, or that the architecture of the substrate was anything even remotely familiar to the experts who were assigned to hack into it. The idea that they could take back the battlecruiser simply by accessing its main computer was almost silly, yet those were his orders.

Information Collecting The Deep State is a surveillance state. China is the surveillance capital of the world. Their citizens are monitored and traced with cameras using facial recognition as well as through their iPhones. Collecting and monitoring personal information in the United States includes data from your laptop camera and microphone. If you can see and speak to another person using an iPhone, then high-tech equipment can see, hear, and record you. Although denied, Siri can listen in not only when you say, “Hey Siri,” but as long as the small box is turned on. The camera and microphone on your home computer can be remotely accessed. Even certain types of alarm systems and certain infant security cameras can be hacked, enabling a person to see into your home. It is interesting that the CEOs of computer companies often place dark tape over their camera and microphone.

The theorem is a hack on discrete number theory that simultaneously disproves the Church-Turing hypothesis (wave if you understood that) and worse, permits NP-complete problems to be converted into P-complete ones. This has several consequences, starting with screwing over most cryptography algorithms—translation: all your bank account are belong to us—and ending with the ability to computationally generate a Dho-Nha geometry curve in real time. This

Justin's parents are getting divorced. Like, really divorced. Forget being in the same room—they can't even be on the same conference call. His mother's bitter and his father's a dick. They're both totally self-absorbed and astoundingly uninterested in anything that has to do with their son. Which is likely how he ended up hacking into an international banking computer system in the first place because Smart Kid + Shitty Parents = Trouble.

Over the decades, the slogans of the young changed, like the seven stages of grief – except they were nowhere close to acceptance. It seemed as though it took everything to get to anger and bargaining, so depression was as far as anyone could get. First it was the armor of irony: YOU DROWNED SANTA CLAUS I MISS FISH Then the anger and the threats: WATER IS NOT FOR PROFIT WHEN DID YOU KNOW MONEY WASN'T ENOUGH? As the decades progressed, revenge took over: NO FOOD NO MERCY BEG AND WE MAY NOT KILL YOU BEG AND WE MAY NOT EAT YOU The most popular was the simplest. Two words. It was everywhere – physical and virtual graffiti, songs and movies, hacks on phones and computers, chants at public events, clothing, even on their bodies. It was a popular tattoo. Some even had it inked – scarred – into their foreheads so anyone looking at them would see it. Turning away was impossible: YOU KNEW

Danil grabs his messenger bag with his computer. We need his help to hack into security cameras and gather information.

The driving force behind many of Israel’s most celebrated defense products is Unit 8200. The intelligence unit of the IDF, it is the equivalent of the National Security Agency (NSA) in the US and is staffed by elite young recruits with an appetite for spying, computer hacking, and surveillance. Its primary goal is mass monitoring of Palestinians in the West Bank and Gaza, detailing all their personal and political information, and listening to communications from allies and foes across the world. This is achieved principally through a base in the Negev desert where lines of satellite dishes suck up domestic and international calls and a range of other communications. The Urim base feeds information to Unit 8200 and Israel collates details from both the base and covert listening posts in its embassies around the globe. Urim is one of the world’s biggest signals intelligence stations.

IBM launched its Chess machine, renamed simply the Personal Computer, in August 1981, a scant four months after the Star. Judged against the technology PARC had brought forth, it was a homely and feeble creature. Rather than bitmapped graphics and variable typefaces, its screen displayed only ASCII characters, glowing a hideous monochromatic green against a black background. Instead of a mouse, the PC had four arrow keys on the keyboard that laboriously moved the cursor, character by character and line by line. No icons, no desktop metaphor, no multitasking windows, no e-mail, no Ethernet. Forswearing the Star’s intuitive point-and-click operability, IBM forced its customers to master an abstruse lexicon of typed commands and cryptic responses developed by Microsoft, its software partner. Where the Star was a masterpiece of integrated reliability, the PC had a perverse tendency to crash at random (a character flaw it bequeathed to many subsequent generations of Microsoft Windows-driven machines). But where the Star sold for $16,595-plus, the IBM PC sold for less than $5,000, all-inclusive. Where the Star’s operating system was closed, accessible for enhancement only to those to whom Xerox granted a coded key, the PC’s circuitry and microcode were wide open to anyone willing to hack a program for it—just like the Alto’s. And it sold in the millions.

Hackworth was a forger, Dr. X was a honer. The distinction was at least as old as the digital computer. Forgers created a new technology and then forged on to the next project, having explored only the outlines of its potential. Honers got less respect because they appeared to sit still technologically, playing around with systems that were no longer start, hacking them for all they were worth, getting them to do things the forgers had never envisioned.

So new hires at Zappos go through a week of training. Then, at the end of those seven days, Hsieh makes them an offer. If they feel Zappos isn’t for them and want to leave, he’ll pay them $2,000—no hard feelings. Hsieh is hacking the Motivation 2.0 operating system like a brilliant and benevolent teenage computer whiz. He’s using an “if-then” reward not to motivate people to perform better, but to weed out those who aren’t fit for a Motivation 3.0–style workplace. The people who remain receive decent pay, and just as important, they have autonomy over technique.

The World Wide Web can be a helpful place for statistics and facts, helpful hacks, and tips, but the digital world is also a place where security measures should be put in place, especially for youth.

What makes you think that?” asked Margaret, echoing my own thoughts. “Superglue in a locker sounds pretty caveman compared to computer hacking.

BUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUMBUM. PPS Sorry, I think my computer has been hacked. By your mum.

My brother. Are you ready?” “Yes,” the other replied. “You realize I’m going to use your computer to hack pm.gov.tn?” “OK,” the main replied. “Tell me what to

An example of the extent of the FSB and GRU covert cyber collection and exploitation was the exposure of what was most likely a Russian State Security & Navy Intelligence covert operation to monitor, exploit and hack targets within the central United States from Russian merchant ships equipped with advanced hacking hardware and tools. The US Coast guard boarded the merchant ship SS Chem Hydra and in it they found wireless intercept equipment associated with Russian hacking teams. Apparently the vessel had personnel on board who were tasked to collect intelligence on wireless networks and attempt hackings on regional computer networks in the heartland of America.59

Governments almost never admit to hacking each other’s computers. Researchers generally infer the country of origin from the target list.

Batteries, Bug repellent, Belts, Bags , Barbecue equipment, Boots, Bath towels. Bikes, Bike rack. C - Cash and credit cards, Cell phones & chargers, Camera and film/memory cards, Coffee pot, Can opener, Cups, Cutlery, Computer, Clock, Cleaning utensils, Clothes and coats, Camping Guides, Condiments (salt, sugar, pepper). D - Dishes, Drainers, Disinfectant. F - First Aid kit, Fire Extinguishers G - Glasses, (drinking, reading, sun), Games. H -Herbs, Hair brushes, Headphones. K -Keys (house, RV, Lockers), Kindle & cable, Kitchen Gadgets. M - Medication. Money belts, Measuring implements, Maps, P - PERSONAL DOCUMENTS: Passports, Health Certificates, Insurance, Driving License, RV documents, Power adapters, Pens, Pets:

reach into my travel bag and pull out my hacked Palm computer,

Increasingly in today’s culture, “hacking” is something done not just by criminals and computer scientists, but by anyone who has the capability to approach a problem laterally. (This is the original usage of the term, in fact.) Can’t get that horrible plastic “blister pak” for those headphones open? Use a can opener. (It works!) Not enough seats for the four of you? Give yours up and weather the storm with the person of your dreams. The first section of this book discusses how some people use such “hacker” thinking to shorten paths to success. It’s how some people take a few years to become president while others spend 30. It’s how unknown comedians get on Saturday Night Live and Internet companies get to millions of users in months. Lateral thinking doesn’t replace hard work; it eliminates unnecessary cycles. Once they’ve shortened their path, overachievers tend to look for ways to do more with their effort,