“
There are very few human beings who receive the truth, complete and staggering, by instant illumination. Most of them acquire it fragment by fragment, on a small scale, by successive developments, cellularly, like a laborious mosaic.
”
”
Anaïs Nin (Journals of Anais Nin Volume 3)
“
However, there is a way to know for certain that Noah’s Flood and the Creation story never happened: by looking at our mitochondrial DNA (mtDNA). Mitochondria are the “cellular power plants” found in all of our cells and they have their own DNA which is separate from that found in the nucleus of the cell. In humans, and most other species that mitochondria are found in, the father’s mtDNA normally does not contribute to the child’s mtDNA; the child normally inherits its mtDNA exclusively from its mother. This means that if no one’s genes have mutated, then we all have the same mtDNA as our brothers and sisters and the same mtDNA as the children of our mother’s sisters, etc. This pattern of inheritance makes it possible to rule out “population bottlenecks” in our species’ history. A bottleneck is basically a time when the population of a species dwindled to low numbers. For humans, this means that every person born after a bottleneck can only have the mtDNA or a mutation of the mtDNA of the women who survived the bottleneck. This doesn’t mean that mtDNA can tell us when a bottleneck happened, but it can tell us when one didn’t happen because we know that mtDNA has a rate of approximately one mutation every 3,500 years (Gibbons 1998; Soares et al 2009). So if the human race were actually less than 6,000 years old and/or “everything on earth that breathed died” (Genesis 7:22) less than 6,000 years ago, which would be the case if the story of Adam and the story of Noah’s flood were true respectively, then every person should have the exact same mtDNA except for one or two mutations. This, however, is not the case as human mtDNA is much more diverse (Endicott et al 2009), so we can know for a fact that the story of Adam and Eve and the story of Noah are fictional. There
”
”
Alexander Drake (The Invention of Christianity)
“
A-la-la-la-la, fine, I get it,” said Thorne, covering his ears. “Please, never say that word again.”
Dr. Erland raised an eyebrow. “Cellular? Hematopoietic? Ganglion?”
“That last one.” Thorne grimaced. “Bleh.”
The doctor scowled. “Are you squeamish, Mr. Thorne?”
“Eye stuff weirds me out. As does any surgery regarding the pelvic bone. You can knock me out for that part, right?” He lay back on the exam table. “Do it fast.
”
”
Marissa Meyer (Cress (The Lunar Chronicles, #3))
“
This is good.”
“Why is it good?” I asked.
He pulled out a stethoscope. “It’s a good indication that the mutation is on a perfect, cellular level.”
“Or an indication that I’m pretty damn awesome,” Daemon suggested coolly.
”
”
Jennifer L. Armentrout (Origin (Lux, #4))
“
I think sex with him might undo my essential cellular cohesion.
”
”
Karen Marie Moning (Faefever (Fever, #3))
“
Long before all these divisions were opened between home and the road, betweens a woman's place and a man's world, humans followed the crops, the seasons, traveling with their families, our companions, animals, our tents. We built campfires and moved from place to place. This way of traveling is still in our cellular memory. Living things have evolved as travelers, Even migrating birds know that nature doesn't demand a choice between nesting and flight.
”
”
Gloria Steinem (My Life on the Road)
“
Houses are cellular walls; they keep our problems from bleeding into everyone else's.
”
”
Jodi Picoult (Handle with Care)
“
Is it surprising that the cellular prison, with its regular chronologies, forced labour, its authorities of surveillance and registration, its experts in normality, who continue and multiply the functions of the judge, should have become the modern instrument of penality? Is it surprising that prisons resemble factories, schools, barracks, hospitals, which all resemble prisons?
”
”
Michel Foucault
“
Even then, more than a year earlier, there were neurons in her head, not far from her ears, that were being strangled to death, too quietly for her to hear them. Some would argue that things were going so insiduously wrong that the neurons themselves initiated events that would lead to their own destruction. Whether it was molecular murder or cellular suicide, they were unable to warn her of what was happening before they died.
”
”
Lisa Genova (Still Alice)
“
All my life and all my experience, the events that have befallen me, the people I have known, all my memories, dreams, fantasies, everything I have ever read, all of that has been chucked onto the compost heap, where over time it has rotted down to a dark, rich, organic mulch. The process of cellular breakdown makes it unrecognizable. Other people call it the imagination. I think of it as a compost heap. Every so often I take an idea, plant it in the compost, and wait. It feeds on the black stuff that used to be a life, takes its energy for its own. It germinates,. Takes root. Produces shoots. And so on and so forth, until one fine day I have a story, or a novel....Readers are fools. They believe all writing is autobiographical. And so it is, but not in the way they think. The writer's life needs time to rot away before it can be used to nourish a work of fiction. It must be allowed to decay.
”
”
Diane Setterfield (The Thirteenth Tale)
“
It is often said that the first sound we hear in the womb is our mother’s heartbeat. Actually, the first sound to vibrate our newly developed hearing apparatus is the pulse of our mother’s blood through her veins and arteries. We vibrate to that primordial rhythm even before we have ears to hear. Before we were conceived, we existed in part as an egg in our mother’s ovary. All the eggs a woman will ever carry form in her ovaries while she is a four-month-old fetus in the womb of her mother. This means our cellular life as an egg begins in the womb of our grandmother. Each of us spent five months in our grandmother’s womb and she in turn formed within the womb of her grandmother. We vibrate to the rhythms of our mother’s blood before she herself is born. . . .
”
”
Ashley Audrain (The Push)
“
I see the mycelium as the Earth's natural Internet, a consciousness with which we might be able to communicate. Through cross-species interfacing, we may one day exchange information with these sentient cellular networks. Because these externalized neurological nets sense any impression upon them, from footsteps to falling tree branches, they could relay enormous amounts of data regarding the movements of all organisms through the landscape.
”
”
Paul Stamets (Mycelium Running: How Mushrooms Can Help Save the World)
“
One of the failures of cellular communication is that tiredness often comes across as sadness.
”
”
Rachel Cohn (Dash & Lily's Book of Dares (Dash & Lily, #1))
“
The well-being of a neuron depends on its ability to communicate with other neurons. Studies have shown that electrical and chemical stimulation from both a neuron's inputs and its targets support vital cellular processes. Neurons unable to connect effectively with other neurons atrophy. Useless, an abandoned neuron will die.
”
”
Lisa Genova (Still Alice)
“
In art, in history man fights his fears, he wants to live forever, he is afraid of death, he wants to work with other men, he wants to live forever. He is like a child afraid of death. The child is afraid of death, of darkness, of solitude. Such simple fears behind all the elaborate constructions. Such simple fears as hunger for light, warmth, love. Such simple fears behind the elaborate constructions of art. Examine them all gently and quietly through the eyes of a boy. There is always a human being lonely, a human being afraid, a human being lost, a human being confused. Concealing and disguising his dependence, his needs, ashamed to say: I am a simple human being in a too vast and complex world. Because of all we have discovered about a leaf...it is still a leaf. Can we relate to a leaf, on a tree, in a park, a simple leaf: green, glistening, sun-bathed or wet, or turning white because the storm is coming. Like the savage, let us look at the leaf wet or shining with sun, or white with fear of the storm, or silvery in the fog, or listless in too great heat, or falling in autumn, dying, reborn each year anew. Learn from the leaf: simplicity. In spite of all we know about the leaf: its nerve structure phyllome cellular papilla parenchyma stomata venation. Keep a human relation -- leaf, man, woman, child. In tenderness. No matter how immense the world, how elaborate, how contradictory, there is always man, woman, child, and the leaf. Humanity makes everything warm and simple. Humanity...
”
”
Anaïs Nin (Children of the Albatross (Cities of the Interior #2))
“
A successful song comes to sing itself inside the listener. It is cellular and seismic, a wave coalescing in the mind and in the flesh. There is a message outside and a message inside, and those messages are the same, like the pat and thud of two heartbeats, one within you, one surrounding. The message of the lullaby is that it’s okay to dim the eyes for a time, to lose sight of yourself as you sleep and as you grow: if you drift, it says, you’ll drift ashore: if you fall, you will fall into place.
”
”
Kevin Brockmeier
“
Medicines cannot drug away the cellular defects that develop in response to improper nutrition throughout life.
”
”
Joel Fuhrman (Super Immunity: The Essential Nutrition Guide for Boosting Your Body's Defenses to Live Longer, Stronger, and Disease Free)
“
All the eggs a woman will every carry form in her ovaries while she is a four-month-old foetus in the womb of her mother. This means our cellular life as en egg begins in the womb of our grandmother. Each of us spent five months in our grandmother's womb, and she in turn formed within the womb of her grandmother. We vibrate to the rhythms of our mother's blood before she herself is born, and this pulse is the thread of blood that runs all the way back through the grandmothers to the first mother.
”
”
Layne Redmond (When The Drummers Were Women: A Spiritual History of Rhythm)
“
What? Was he raised in a barn? Didn’t he ever learn how to close a door? Amateur shape-shifters…No manners whatsoever.” – Sasha
“Do we need to get you a Midol before we go?” – Sundown
“I’m not that easy to soothe, cowboy. My peeves are on a cellular level.” – Sasha
”
”
Sherrilyn Kenyon (Retribution (Dark-Hunter, #19))
“
People walk the paths of the gardens below, and the wind sings anthems in the hedges, and the big old cedars at the entrance to the maze creak. Marie-Laure imagines the electromagnetic waves traveling into and out of Michel’s machine, bending around them, just as Etienne used to describe, except now a thousand times more crisscross the air than when he lived - maybe a million times more. Torrents of text conversations, tides of cell conversations, of televisions programs, of e-mails, vast networks of fiber and wire interlaced above and beneath the city, passing through buildings, arcing between transmitters in Metro tunnels, between antennas atop buildings, from lampposts with cellular transmitters in them, commercials for Carrefour and Evian and prebaked toaster pastries flashing into space and back to earth again, I am going to be late and Maybe we should get reservations? and Pick up avocados and What did he say? and ten thousand I miss yous, fifty thousand I love yous, hate mail and appointment reminders and market updates, jewelry ads, coffee ads, furniture ads flying invisibly over the warrens of Paris, over the battlefields and tombs, over the Ardennes, over the Rhine, over Belgium and Denmark, over the scarred and ever-shifting landscape we call nations. And is it so hard to believe that souls might also travel those paths? That her father and Etienne and Madame Manec and the German boy named Werner Pfennig might harry the sky in flocks, like egrets, like terns, like starlings? That great shuttles of souls might fly about, faded but audible if you listen closely enough? They flow above the chimneys, ride the sidewalks, slip through your jacket and shirt and breastbone and lungs, and pass out through the other side, the air a library and the record of every life lived, every sentence spoken, every word transmitted still reverberating within it.
Every hour, she thinks, someone for whom the war was memory falls out of the world.
We rise again in the grass. In the flowers. In songs.
”
”
Anthony Doerr (All the Light We Cannot See)
“
Skill is a cellular insulation that wraps neural circuits and that grows in response to certain signals.
”
”
Daniel Coyle (The Talent Code: Greatness isn't born. It's grown)
“
Because the bad things you do become part of you, literally. This is no metaphor. They become part of you on a cellular level, in the blood.
”
”
Megan Abbott (Give Me Your Hand)
“
There are sounds, of course, but compared to the marsh, the swamp is quiet because decomposition is cellular work.
”
”
Delia Owens (Where the Crawdads Sing)
“
When you arrive in your driveway and turn off the car, you remain behind the wheel another ten minutes. You fear the night is being locked in and coded on a cellular level and want time to function as a power wash. Sitting there staring at the closed garage door you are reminded that a friend once told you there exists the medical term—John Henryism—for people exposed to stresses stemming from racism. They achieve themselves to death trying to dodge the buildup of erasure. Sherman James, the researcher who came up with the term, claimed the physiological costs were high. You hope by sitting in silence you are bucking the trend.
”
”
Claudia Rankine (Citizen: An American Lyric)
“
Indeed, the underlying precept of the new science of mind is that all mental processes are biological—they all depend on organic molecules and cellular processes that occur literally “in our heads.” Therefore, any disorder or alteration of those processes must also have a biological basis.
”
”
Eric R. Kandel (In Search of Memory: The Emergence of a New Science of Mind)
“
Viscosity occurs on a cellular level. And so does velocity.In contrast to viscosity's cellular coma, velocity endows every platelet and muscle fiber with a mind of its own, a means of knowing and commenting on its own behavior. There is too much perception, and beyond the plethora of perceptions, a plethora of thoughts about the perceptions and about the fact of having perceptions. Digestion could kill you! What I mean is the unceasing awareness of the processes of digestion could exhaust you to death. And digestion is just an involuntary sideline to thinking, which is where the real trouble begins
”
”
Susanna Kaysen (Girl, Interrupted)
“
Smallness is subversive, because smallness can creep into smaller places and wreak transformation at the most vulnerable, cellular level. In a time when largeness is threatening to topple us, I wish to remember and praise the beauty of smallness, in order to banish the Goliath of loneliness.
”
”
Sarah Ruhl (100 Essays I Don't Have Time to Write: On Umbrellas and Sword Fights, Parades and Dogs, Fire Alarms, Children, and Theater)
“
A smartphone is an addictive device which traps a soul into a lifeless planet full of lives
”
”
Munia Khan
“
Marsh is not swamp. Marsh is a space of light, where grass grows in water, and water flows into the sky. Slow-moving creeks wander, carrying the orb of the sun with them to the sea, and long-legged birds lift with unexpected grace—as though not built to fly—against the roar of a thousand snow geese. Then within the marsh, here and there, true swamp crawls into low-lying bogs, hidden in clammy forests. Swamp water is still and dark, having swallowed the light in its muddy throat. Even night crawlers are diurnal in this lair. There are sounds, of course, but compared to the marsh, the swamp is quiet because decomposition is cellular work. Life decays and reeks and returns to the rotted duff; a poignant wallow of death begetting life.
”
”
Delia Owens (Where the Crawdads Sing)
“
We like beauty, don’t we? Something good on the eye cheers us. Does something to us on a cellular level, makes us feel alive and enriched. Beautiful art opens our eyes to the beauty of the world, Ulysses. It repositions our sight and judgment. Captures forever that which is fleeting. A meager stain in the corridors of history, that’s all we are. A little mark of scuff.
”
”
Sarah Winman (Still Life)
“
When I started reading the literature of molecular biology, I was stunned by certain descriptions. Admittedly, I was on the lookout for anything unusual, as my investigation had led me to consider that DNA and its cellular machinery truly were an extremely sophisticated technology of cosmic origin. But as I pored over thousands of pages of biological texts, I discovered a world of science fiction that seemed to confirm my hypothesis. Proteins and enzymes were described as 'miniature robots,' ribosomes were 'molecular computers,' cells were 'factories,' DNA itself was a 'text,' a 'program,' a 'language,' or 'data.' One only had to do a literal reading of contemporary biology to reach shattering conclusions; yet most authors display a total lack of astonishment and seem to consider that life is merely 'a normal physiochemical phenomenon.
”
”
Jeremy Narby (The Cosmic Serpent: DNA and the Origins of Knowledge)
“
She had long ago implanted herself in me at the cellular level, spread into my organs—my brain, my heart—until what was hers and what was mine were indistinguishable.
”
”
Melissa Broder (Milk Fed)
“
... I have come to the part of the night where I am incapable of any uppercase emotion, and every circuit responsible for my cellular regeneration has begun to smoke.
”
”
Raven Leilani (Luster)
“
We tend to give much less consideration to how we feel. But how you feel is the earliest indicator of your health on a cellular level.
”
”
Katy Bowman (Move Your DNA)
“
The heart beneath the breastbone pumping. The blood on its appointed rounds. Life in small places, narrow crannies. In the leaves, the toad's pulse. The delicate cellular warfare in a waterdrop. A dextrocardiac, said the smiling doctor. Your heart's in the right place. Weathershrunk and loveless. The skin drawn and split like an overripe fruit.
”
”
Cormac McCarthy (Suttree)
“
When an apple has ripened and falls, why does it fall? Because of its attraction to the earth, because its stalk withers, because it is dried by the sun, because it grows heavier, because the wind shakes it, or because the boy standing below wants to eat it?
Nothing is the cause. All this is only the coincidence of conditions in which all vital organic and elemental events occur. And the botanist who finds that the apple falls because the cellular tissue decays and so forth is equally right with the child who stands under the tree and says the apple fell because he wanted to eat it and prayed for it.
”
”
Leo Tolstoy (War and Peace)
“
When I fight off a disease bent on my cellular destruction, when I marvelously distribute energy and collect waste with astonishing alacrity even in my most seemingly fatigued moments, when I slip on ice and gyrate crazily but do not fall, when I unconsciously counter-steer my way into a sharp bicycle turn, taking advantage of physics I do not understand using a technique I am not even aware of using, when I somehow catch the dropped oranges before I know I've dropped them, when my wounds heal in my ignorance, I realize how much bigger I am than I think I am. And how much more important, nine times out of ten, those lower-level processes are to my overall well-being than the higher-level ones that tend to be the ones getting me bent out of shape or making me feel disappointed or proud.
”
”
Brian Christian (The Most Human Human: What Talking with Computers Teaches Us About What It Means to Be Alive)
“
Under the pathologist's microscope, life and death fight in an illuminated circle in a sort of cellular bullfight. The pathologist's job is to find the bull among the matador cells
”
”
Yann Martel (The High Mountains of Portugal)
“
In the community of living tissues, the uncontrolled mob of misfits that is cancer behaves like a gang of perpetually wilding adolescents. They are the juvenile delinquents of cellular society.
”
”
Sherwin B. Nuland (How We Die: Reflections of Life's Final Chapter)
“
Maybe a family is linked in ways we have no way to understand. Some unseen, cellular connection that binds us past and present. If so, perhaps when my brother died, those cells we shared died as well. And for us, that would have been the heart. Those fine, fragile walls that let us embrace life with fearlessness and faith. We suffer because our heart is dying, one small cell at a time.
”
”
Naseem Rakha (The Crying Tree)
“
But the fatigue of physical dysfunction, I came to recognize, is as different from normal sleep deprivation as COVID-19 is from the common cold. It was not caused by needing sleep, I thought, but by my body’s cellular conviction that it needed to conserve energy in order to fix whatever was wrong. The feeling erased my will, the sense of identity that drives most of us. The worst part of my fatigue was the loss of an intact sense of self.
”
”
Meghan O'Rourke (The Invisible Kingdom: Reimagining Chronic Illness)
“
Individual humans are not super, but the organism of which we are all tiny cellular parts is most certainly that. The life-form that's so big we forget it's there, that turns minerals on its planet into tools to touch the infinite black gap between stars or probe the obliterating pressures at the bottom of the oceans. We are already part of a superbeing, a monster, a god, a living process that is so all encompassing that it is to an individual life what water is to a fish. We are cells in the body of a three-billion-year-old life-form whose roots are in the Precambrian oceans and whose genetic wiring extends through the living structures of everything on the planet, connecting everything that has ever lived in one immense nervous system.
”
”
Grant Morrison (Supergods: What Masked Vigilantes, Miraculous Mutants, and a Sun God from Smallville Can Teach Us About Being Human)
“
But maybe some things could never be erased. Maybe they tinted some cellular level of your experience, and even if you scraped away whatever part was on the surface, the rot had already gotten beneath.
”
”
Emma Cline (The Guest)
“
Someone has already taken out a Minolta cellular phone and called for a car, and then, when I'm not really listening, watching instead someone who looks remarkably like Marcus Halberstam paying a check, someone asks, simply, not in relation to anything, "Why? " and though I'm very proud that I have cold blood and that I can keep my nerve and do what I'm supposed to do, I catch something, then realize it: Why? and automatically answering, out of the blue, for no reason, just opening my mouth, words coming out, summarizing for the idiots: "Well, though I know I should have done that instead of not doing it, I'm twenty-seven for Christ sakes and this is, uh, how life presents itself in a bar or in a club in New York, maybe anywhere, at the end of the century and how people, you know, me, behave, and this is what being Pat rick means to me, I guess, so, well, yup, uh..." and this is followed by a sigh, then a slight shrug and another sigh, and above one of the doors covered by red velvet drapes in Harry's is a sign and on the sign in letters that match the drapes' color are the words THIS IS NOT AN EXIT.
”
”
Bret Easton Ellis (American Psycho)
“
Liquids require receptacles. This is the great problem of packaging, which every experienced chemist knows: and it was well known to God Almighty, who solved it brilliantly, as he is wont to, with cellular membranes- eggshells, the multiple peel of oranges, and our own skin, because after all we too are liquids. Now, at that time, there did not exist polyethylene, which would have suited me perfectly since it is flexible, light, and splendidly impermeable: but it is also a bit too incorruptible, and not by chance God Almighty himself, although he is a master of polymerization, abstained from patenting it: He does not like incorruptible things.
”
”
Primo Levi (The Periodic Table)
“
J&B I am thinking. Glass of J&B in my right hand I am thinking. Hand I am thinking. Charivari. Shirt from Charivari. Fusilli I am thinking. Jami Gertz I am thinking. I would like to fuck Jami Gertz I am thinking. Porsche 911. A sharpei I am thinking. I would like to own a sharpei. I am twenty-six years old I am thinking. I will be twenty-seven next year. A Valium. I would like a Valium. No, two Valium I am thinking. Cellular phone I am thinking.
”
”
Bret Easton Ellis (American Psycho)
“
On an impulse he switched out the light on his desk and sat in the hot darkness of his office; the cold air filled his lungs, and he leaned toward the open window. He heard the silence of the winter night, and it seemed to him that he somehow felt the sounds that were absorbed by the delicate and intricately cellular being of the snow. Nothing moved upon the whiteness; it was a dead scene, which seemed to pull at him, to suck at his consciousness just as it pulled the sound from the air and buried it within a cold white softness. He felt himself pulled outward toward the whiteness, which spread as far as he could see, and which was a part of the darkness from which it glowed, of the clear and cloudless sky without height or depth. For an instant he felt himself go out of the body that sat motionless before the window; and as he felt himself slip away, everything—the flat whiteness, the trees, the tall columns, the night, the far stars—seemed incredibly tiny and far away, as if they were dwindling to a nothingness.
”
”
John Williams (Stoner)
“
IT IS STARTLING to think that all Europe once looked like this Puszcza. To enter it is to realize that most of us were bred to a pale copy of what nature intended. Seeing elders with trunks seven feet wide, or walking through stands of the tallest trees here—gigantic Norway spruce, shaggy as Methuselah—should seem as exotic as the Amazon or Antarctica to someone raised among the comparatively puny, second-growth woodlands found throughout the Northern Hemisphere. Instead, what’s astonishing is how primally familiar it feels. And, on some cellular level, how complete.
”
”
Alan Weisman (The World Without Us)
“
Conflicting egos destroy many relationships. Lasting, stable marriages are a true treasure because they demand that both parties adjust to the constant cellular flux of their partner as they metaphase through changing seasons of life.
”
”
Kilroy J. Oldster (Dead Toad Scrolls)
“
It is often said that the first sound we hear in the womb is our mother's heartbeat. Actually, the first sound to vibrate our newly developed hearing apparatus is the pulse of our mother's blood through her veins and arteries. We vibrate to that primordial rhythm even before we have ears to hear. Before we were conceived, we existed in part as an egg in our mother's ovary. All the eggs a woman will ever carry form in her ovaries while she is a four-month-old fetus in the womb of her mother. This means our cellular life as an egg begins in the womb of our grandmother. Each of us spent five months in our grandmother's womb and she in turn formed within the womb of her grandmother. We vibrate to the rhythms of our mother's blood before she herself is born. And this pulse is the thread of blood that runs all the way back through the grandmothers to the first mother. We all share the blood of the first mother. We are truly children of one blood.
”
”
Layne Redmond (When The Drummers Were Women: A Spiritual History of Rhythm)
“
addition to priming our state of mind, exercise influences learning directly, at the cellular level, improving the brain’s potential to log in and process new information.
”
”
John J. Ratey (Spark)
“
I stared back at him with something that, I realize now, was close to cellular recognition. In one glance, he recalled my father, my first boyfriend, my college love, my future.
”
”
Alison Singh Gee
“
I knew I was going to be a cellular biologist whose research would focus on scrutinizing every nuance of the cell's ultrastructure to gain insights into the secrets of cellular life.
”
”
Bruce H. Lipton (The Biology Of Belief: Unleashing The Power Of Consciousness, Matter And Miracles)
“
Every second a million petitions wing past the ear of God. Let it be door number two. Get Janet through this. Make Mom fall in love again, make the pain go away, make this key fit. If I fish this cove, plant this field, step into this darkness, give me the strength to see it through. Help my marriage, my sister, me. What will this fund be worth in thirteen days? In thirteen years? Will I be around in thirteen years? And the most unanswerable of unanswerables: Don't let me die. And: What will happen afterward? Chandeliers and choirs? Flocks of souls like starlings harrying across the sky? Eternity; life again as bacteria, or as sunflowers, or as a leatherback turtle; suffocating blackness; cessation of all cellular function.
”
”
Anthony Doerr (About Grace)
“
Auxochrome — Chromophore. Diego. She who wears the color. He who sees the color. Since the year 1922. Until always and forever. Now in 1944. After all the hours lived through. The vectors continue in their original direction. Nothing stops them. With no more knowledge than live emotion. With no other wish than to go on until they meet. Slowly. With great unease, but with the certainty that all is guided by the “golden section.” There is cellular arrangement. There is movement. There is light. All centers are the same. Folly doesn’t exist. We are the same as we were and as we will be. Not counting on idiotic destiny.
”
”
Frida Kahlo
“
feel like some sense of memory makes us attracted to places our ancestors knew, celebrate dates that were important in the past, and become drawn to people whose family once crossed paths with ours without our even knowing it. Call it psychogenealogy, or cellular memory . . . all I know is, this isn’t just chance.
”
”
Anne Berest (The Postcard)
“
I am trying to stress a point which they do not sufficiently emphasize, or tend to overlook altogether-namely, that the organism is not a mosaic aggregate of elementary physico-chemical processes, but a hierarchy in which each member, from the sub-cellular level upward, is a closely integrated structure, equipped with self-regulatory devices, and enjoys an advanced form of self-government.
”
”
Arthur Koestler (The Ghost in the Machine)
“
...how is it possible that our thoughts don't change our bodies on a cellular level? It seems inconceivable that the workings of my blood and bones and organs aren't affected by the knowledge I obtain. How can information that shakes your reality be limited to the thoughts that dwell in your mind?
”
”
Gracie Ruth Mitchell (Juniper Bean Resorts to Murder (Happily Ever Homicide, #1))
“
Before we were conceived, we existed in part as an egg in our mother’s ovary. All the eggs a woman will ever carry form in her ovaries while she is a four-month-old fetus in the womb of her mother. This means our cellular life as an egg begins in the womb of our grandmother. Each of us spent five months in our grandmother’s womb and she in turn formed within the womb of her grandmother. We vibrate to the rhythms of our mother’s blood before she herself is born.
”
”
Ashley Audrain (The Push)
“
I'll give them my number, too. And my brother Vishous made sure we have the best reception and service in the city. No dead zones. Unless you're around Lassiter, and that's more of a mental thing than anything about cellular networks."
"Um ... Lassiter?" Bitty said.
Rhage nodded. "Yeah, he's this pain in the ass--oh, shit--I mean, sorry, I shouldn't say ass around you, should I? Or shit. And all those other bad words." He poked himself in the head. "I gotta remember that, gotta remember that. Anyway, Lassiter's a fallen angel who we've somehow gotten stuck with. He's like gum on the bottom of your shoe. 'Cept he doesn't smell like strawberries, he hogs the T.V. remote, and on a regular basis. you think to yourself, Is that really the best the Creator could do with an immortal? The guy has the worst taste in television--I mean, the only saving grace is that he isn't addicted to Bonanza ...have you ever watched twelve straight hours of Saved by the Bell? Okay, fine, it was probably only seven, and it wasn't like I couldn't have left--my God, I tell you, though, it's a wonder I escaped with my ability to put my pants on one leg at a time still intact ...
”
”
J.R. Ward (The Beast (Black Dagger Brotherhood, #14))
“
Even the poorest and most squalid life is an Aeschylean drama, if you think about the tragedy of the bodily functions, the whispering of the secretions, the silence of the organs, the exertions of memory, the groping of the voice, the blood that courses, the mortal miasmas, the riots among microorganisms, the spermatic wars, the cellular eruptions, the pestilences of the nerves, the biochemical predestinations, and the fate that slowly but surely introduces you to the final infection, to the sores, the exploded boils, the snakes of madness, the furious bitches of Hunger.
”
”
Guido Ceronetti (The Silence of the Body: Materials for the Study of Medicine)
“
Swamp water is still and dark, having swallowed the light in its muddy throat. Even night crawlers are diurnal in this lair. There are sounds, of course, but compared to the marsh, the swamp is quiet because decomposition is cellular work. Life decays and reeks and returns to the rotted duff; a poignant wallow of death begetting life.
”
”
Delia Owens (Where the Crawdads Sing)
“
I accept this recalibration. No matter what is in my body at this moment, it can be gone. If it’s inappropriate, it can be gone. I stand as a piece of divinity on this planet – wise, appropriate, and I belong here. This is my time. Cellular structure, listen: If there’s anything inappropriate, let it be gone. Let it wash away with the waste. Let it go out because it is not seen as appropriate, it is not commensurate to the energy of the love of God. Let only compassionate things enter my consciousness.
”
”
Lee Carroll (The Recalibration of Humanity: 2013 and Beyond)
“
Dear cellular structure, I wish to have the attributes that I have earned in what I call my past that will enhance the ability for me to live my current life with more ease and grace. I wish to recall those things that will allow me to live longer, do my work better, and give me peace over the things that I desire to do. I wish to mine the Akash for this, which is in my personal DNA.” So, do you see what is happening here?
”
”
Lee Carroll (The Twelve Layers of DNA: An Esoteric Study of the Mastery Within (Kryon #12))
“
The longest-lasting cells in a human body live around seven years, so once they’re gone, once the longest surviving cells in your body have turned over and been replaced, and your skin and hair and blood cells have already turned over many thousands of times, you are biologically a different person. No physical cells of the old you remain. If that’s true, no cellular part of the me that loved Buck remains. But somehow, love remains.
”
”
Constance Wu (Making a Scene)
“
Johannes Gutenberg’s printing press created a surge in demand for spectacles, as the new practice of reading made Europeans across the continent suddenly realize that they were farsighted; the market demand for spectacles encouraged a growing number of people to produce and experiment with lenses, which led to the invention of the microscope, which shortly thereafter enabled us to perceive that our bodies were made up of microscopic cells. You wouldn’t think that printing technology would have anything to do with the expansion of our vision down to the cellular scale, just as you wouldn’t have thought that the evolution of pollen would alter the design of a hummingbird’s wing. But that is the way change happens.
”
”
Steven Johnson (How We Got to Now: Six Innovations That Made the Modern World)
“
As we ascend to the hierarchies of living matter, we find, even on the lowest level observable through the electron microscope, sub-cellular structures-organelles-of staggering complexity. And the most striking fact is that these minuscule parts of the cell function as self-governing wholes in their own right, each following its own statute-book of rules. One type of organelles look as quasi-independent agencies after the cell's growth; others after its energy supply, reproduction, communications, and so on.
”
”
Arthur Koestler (The Ghost in the Machine)
“
Molti uomini sono lâches. Lasciano andar via. Lasciano partire. Lasciano perdere. Perché non vogliono confrontarsi direttamente col dolore. Non sopportano di sentirsi impotenti.
E allora cambiano discorso. Oppure riagganciano il telefono. Oppure cominciano a guardare distrattamente gli sms che arrivano sul cellulare per poi dirti che è proprio un peccato, che non possono
farci nulla, ma che adesso devono proprio andarsene.
”
”
Michela Marzano (Volevo essere una farfalla)
“
It is perhaps a little humbling to discover that we as humans are in effect computationally no more capable than cellular automata with very simple rules. But the Principle of Computational Equivalence also implies that the same is ultimately true of our whole universe.
So while science has often made it seem that we as humans are somehow insignificant compared to the universe, the Principle of Computational Equivalence now shows that in a certain sense we are at the same level as it is. For the principle implies that what goes on inside us can ultimately achieve just the same level of computational sophistication as our whole universe.
”
”
Stephen Wolfram (A New Kind of Science)
“
Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).
”
”
Nick Land (Fanged Noumena: Collected Writings 1987 - 2007)
“
If I were to start a file on things nobody tells you about until you’re right in the thick of them, I might begin with miscarriages. A miscarriage is lonely, painful, and demoralizing almost on a cellular level. When you have one, you will likely mistake it for a personal failure, which it is not. Or a tragedy, which, regardless of how utterly devastating it feels in the moment, it also is not. What nobody tells you is that miscarriage happens all the time, to more women than you’d ever guess, given the relative silence around it. I learned this only after I mentioned that I’d miscarried to a couple of friends, who responded by heaping me with love and support and also their own miscarriage stories. It didn’t take away the pain, but in unburying their own struggles, they steadied me during mine, helping me see that what I’d been through was no more than a normal biological hiccup, a fertilized egg that, for what was probably a very good reason, had needed to bail out.
”
”
Michelle Obama (Becoming)
“
Her cells were part of research into the genes that cause cancer and those that suppress it; they helped develop drugs for treating herpes, leukemia, influenza, hemophilia, and Parkinson’s disease; and they’ve been used to study lactose digestion, sexually transmitted diseases, appendicitis, human longevity, mosquito mating, and the negative cellular effects of working in sewers.
”
”
Rebecca Skloot (The Immortal Life of Henrietta Lacks)
“
It is unsettling to find how little it takes to defeat success in medicine. You come as a professional equipped with expertise and technology. You do not imagine that a mere matter of etiquette could foil you. But the social dimension turns out to be as essential as the scientific--matters of how casual you should be, how formal, how reticent, how forthright. Also: how apologetic, how self-confident, how money-minded. In this work against sickness, we begin not with genetic or cellular interactions, but with human ones. They are what make medicine so complex and fascinating. How each interaction is negotiated can determine whether a doctor is trusted, whether a patient is heard, whether the right diagnosis is made, the right treatment given. But in this realm there are no perfect formulas.
”
”
Atul Gawande (Better: A Surgeon's Notes on Performance)
“
I have been all things, black and white ,short and tall, rich and poor, orphaned, homeless, ostracized, Gay, Asian, Jewish , Moslem, ridiculed and ridiculous ,laughed at, admired, worshipped, burnt at the stake, murdered and a murderer, sick and healthy, right and wrong and the list goes on and on...Accessing all that in our cellular memory how can one feel anything but love for all, since we are one and all!
”
”
Lenita Vangellis
“
If the things we eat have been processed—manipulated, broken apart, adulterated, with most of the fiber (and nutrients) thrown away—then we end up consuming something that’s food, technically speaking, but lacks many of the health benefits that eating is supposed to bring us. We get calories—which we need to survive, of course—but little else. None of the nutrition. As Dr. Fuhrman puts it, we end up mechanically full but nutritionally starved. If we do that often enough, we will absolutely harm ourselves at the cellular level. Over time, that may bring about some chronic condition.
”
”
Darin Olien (SuperLife: The 5 Simple Fixes That Will Make You Healthy, Fit, and Eternally Awesome)
“
Life is compost. You think that a strange thing to say, but it's true. All my life and all my experience, the events that have befallen me, the people I have known, all my memories, dreams, fantasies, everything I have ever read, all of that has been chucked onto the compost heap, where over time it had rotted down to a dark, rich, organic mulch. The process of cellular breakdown makes it unrecognizable. Other people call it the imagination. I think of it as a compost heap. Every so often I take an idea, plant it in the compost, and wait. It feeds on that black stuff that used to be a life, takes its energy for its own. It germinates. Takes root. Produces shoots. And so on and so forth, until one fine day I have a story, or a novel.
”
”
Diane Setterfield (The Thirteenth Tale)
“
When you get famous, dinner isn’t food anymore; it’s twenty ounces of protein, ten ounces of carbohydrates, salt-free, fat-free, sugar-free fuel. This is a meal every two hours, six times a day. Eating isn’t about eating anymore. It’s about protein assimilation.
It’s about cellular rejuvenation cream. Washing is about exfoliation. What used to be breathing is respiration.
I’d be the first to congratulate anybody if they could do a better job of faking flawless beauty and delivering vague inspiring messages:
Calm down. Everyone, breathe deep. Life is good. Be just and kind. Be the love.
”
”
Chuck Palahniuk (Survivor)
“
We have given teens more money, so they can construct their own social and material worlds more easily. We have given them more time to spend among themselves — and less time in the company of adults. We have given them e-mail and beepers and, most of all, cellular phones, so that they can fill in all the dead spots in their day — dead spots that might once have been filled with the voices of adults — with the voices of their peers. That is a world ruled by the logic of word of mouth, by the contagious messages that teens pass among themselves. Columbine is now the most prominent epidemic of isolation among teenagers. It will not be the last.
”
”
Malcolm Gladwell (The Tipping Point: How Little Things Can Make a Big Difference)
“
Mortality is inscribed in your cellular structure, and you say you’re not ill? Look at the painting. Look at it.” She nods towards The Adoration of the Magi. I obey. I always will. “Thirteen subjects, if you count them, like the Last Supper. Shepherds, the Magi, the relatives. Study their faces, one by one. Who believes this newborn manikin can one day conquer death? Who wants proof? Who suspects the Messiah is a false prophet? Who knows that he is in a painting, being watched? Who is watching you back?
”
”
David Mitchell (The Bone Clocks)
“
On any one day on Wy'East, one million living things lose their lives. They die, are killed, are shredded, fade out, are gulped, expire, decease, pass from this plane, cease to function, demise, commence decomposition, transition to the next stage, initiate cellular breakdown. This is the way it is. Some live a day, and some live a thousand years. Some are smaller than this comma, and some are taller than you can measure with your eye. Some are serence and eat sunlight and rain and do not slay theyir neighbors and do not battle for supremacy and sex and speak a patient green language. Others are vigorous and furious and muscular and speak the languages of blood and bone. This is the way it is...They change, they morph, they evolve, they go extinct, they sink back into the earth from which we all came and shall return. This is the way it is. It may be that every death is mourned, though most go unremarked, and every day's million deaths causes a million other hearts to sag. Who is to say that is not the way it is?
”
”
Brian Doyle (Martin Marten)
“
Literature --which is art married to thought, and realization untainted by reality--seems to me the end towards which all human effort would have to strive, if it were truly human and not just a welling up of our animal self. To express something is to conserve its virtue and take away its terror. Fields are greener in their description than in their actual greenness. Flowers, if described with phrases that define them in the air of the imagination, will have colours with a durability not found in cellular life.
”
”
Fernando Pessoa (The Book of Disquiet)
“
He looked at them and saw their faces did not fit. The skin on the skulls crawled and twitched like half-solid paste. All the heads in his angle of vision seemed irregular lumps, like potatoes but without a potato’s repose: potatoes with crawling surfaces punctured by holes which opened and shut, holes blocked with coloured jelly or fringed with bone stumps, elastic holes through which air was sucked or squirted, holes secreting salt, wax, spittle and snot. He grasped a pencil in his trouser pocket, wishing it were a knife he could thrust through his cheek and use to carve his face down to the clean bone. But that was foolish. Nothing clean lay under the face. He thought of sectioned brains, palettes, eyeballs and ears seen in medical diagrams and butcher’s shops. He thought of elastic muscle, pulsing tubes, gland sacks full of lukewarm fluid, the layers of cellular and fibrous and granular tissues inside a head. What was felt as tastes, caresses, dreams and thoughts could be seen as a cleverly articulated mass of garbage.
”
”
Alasdair Gray (Lanark)
“
The secret to battling cancer, then, is to find means to prevent these mutations from occurring in susceptible cells, or to find means to eliminate the mutated cells without compromising normal growth. The conciseness of that statement belies the enormity of the task. Malignant growth and normal growth are so genetically intertwined that unbraiding the two might be one of the most significant scientific challenges faced by our species. Cancer is built into our genomes: the genes that unmoor normal cell division are not foreign to our bodies, but rather mutated, distorted versions of the very genes that perform vital cellular functions. And cancer is imprinted in our society: as we extend our life span as a species, we inevitably unleash malignant growth (mutations in cancer genes accumulate with aging; cancer is thus intrinsically related to age). If we seek immortality, then so, too, in a rather perverse sense, does the cancer cell.
”
”
Siddhartha Mukherjee (The Emperor of All Maladies: A Biography of Cancer)
“
All Carolina folk are crazy for mayonnaise, mayonnaise is as ambrosia to them, the food of their tarheeled gods. Mayonnaise comforts them, causes the vowels to slide more musically along their slow tongues, appeasing their grease-conditioned taste buds while transporting those buds to a place higher than lard could ever hope to fly. Yellow as summer sunlight, soft as young thighs, smooth as a Baptist preacher's rant, falsely innocent as a magician's handkerchief, mayonnaise will cloak a lettuce leaf, some shreds of cabbage, a few hunks of cold potato in the simplest splendor, restyling their dull character, making them lively and attractive again, granting them the capacity to delight the gullet if not the heart. Fried oysters, leftover roast, peanut butter: rare are the rations that fail to become instantly more scintillating from contact with this inanimate seductress, this goopy glory-monger, this alchemist in a jar.
The mystery of mayonnaise-and others besides Dickie Goldwire have surely puzzled over this_is how egg yolks, vegetable oil, vinegar (wine's angry brother), salt, sugar (earth's primal grain-energy), lemon juice, water, and, naturally, a pinch of the ol' calcium disodium EDTA could be combined in such a way as to produce a condiment so versatile, satisfying, and outright majestic that mustard, ketchup, and their ilk must bow down before it (though, a at two bucks a jar, mayonnaise certainly doesn't put on airs)or else slink away in disgrace. Who but the French could have wrought this gastronomic miracle? Mayonnaise is France's gift to the New World's muddled palate, a boon that combines humanity's ancient instinctive craving for the cellular warmth of pure fat with the modern, romantic fondness for complex flavors: mayo (as the lazy call it) may appear mild and prosaic, but behind its creamy veil it fairly seethes with tangy disposition. Cholesterol aside, it projects the luster that we astro-orphans have identified with well-being ever since we fell from the stars.
”
”
Tom Robbins (Villa Incognito)
“
I believe that the mycelium operates at a level of complexity that exceeds the computational powers of our most advanced supercomputers. I see the myce-lium as the Earth’s natural Internet, a consciousness with which we might be able to communicate. Through cross-species interfacing, we may one day exchange information with these sentient cellular networks. Because these externalized neurological nets sense any impression upon them, from footsteps to falling tree branches, they could relay enormous amounts of data regarding the movements of all organisms through the landscape. A new bioneering science could be born, dedicated to programming myconeurological networks to monitor and respond to threats to environments. Mycelial webs could be used as information platforms for mycoengineered ecosystems.
”
”
Paul Stamets (Mycelium Running: How Mushrooms Can Help Save the World)
“
There’s a cellular automaton called TVC. After Turing, von Neumann and Chiang. Chiang’s version was N-dimensional. That leaves plenty of room for data within easy reach. In two dimensions, the original von Neumann machine had to reach further and further - and wait longer and longer - for each successive bit of data. In a six-dimensional TVC automaton, you can have a three-dimensional grid of computers, which keeps on growing indefinitely - each with its own three-dimensional memory, which can also grow without bound.
And when the simulated TVC universe being run on the physical computer is suddenly shut down, the best explanation for what I’ve witnessed will be a continuation of that universe - an extension made out of dust. Maria could almost see it: a vast lattice of computers, a seed of order in a sea of random noise, extending itself from moment to moment by sheer force of internal logic, “accreting” the necessary building blocks from the chaos of non-space-time by the very act of defining space and time.
”
”
Greg Egan (Permutation City)
“
Consider the genesis of a single-celled embryo produced by the fertilization of an egg by a sperm. The genetic material of this embryo comes from two sources: paternal genes (from sperm) and maternal genes (from eggs). But the cellular material of the embryo comes exclusively from the egg; the sperm is no more than a glorified delivery vehicle for male DNA—a genome equipped with a hyperactive tail. Aside from proteins, ribosomes, nutrients, and membranes, the egg also supplies the embryo with specialized structures called mitochondria. These mitochondria are the energy-producing factories of the cell; they are so anatomically discrete and so specialized in their function that cell biologists call them “organelles”—i.e., mini-organs resident within cells. Mitochondria, recall, carry a small, independent genome that resides within the mitochondrion itself—not in the cell’s nucleus, where the twenty-three pairs of chromosomes (and the 21,000-odd human genes) can be found. The exclusively female origin of all the mitochondria in an embryo has an important consequence. All humans—male or female—must have inherited their mitochondria from their mothers, who inherited their mitochondria from their mothers, and so forth, in an unbroken line of female ancestry stretching indefinitely into the past. (A woman also carries the mitochondrial genomes of all her future descendants in her cells; ironically, if there is such a thing as a “homunculus,” then it is exclusively female in origin—technically, a “femunculus”?) Now imagine an ancient tribe of two hundred women, each of whom bears one child. If the child happens to be a daughter, the woman dutifully passes her mitochondria to the next generation, and, through her daughter’s daughter, to a third generation. But if she has only a son and no daughter, the woman’s mitochondrial lineage wanders into a genetic blind alley and becomes extinct (since sperm do not pass their mitochondria to the embryo, sons cannot pass their mitochondrial genomes to their children). Over the course of the tribe’s evolution, tens of thousands of such mitochondrial lineages will land on lineal dead ends by chance, and be snuffed out. And here is the crux: if the founding population of a species is small enough, and if enough time has passed, the number of surviving maternal lineages will keep shrinking, and shrinking further, until only a few are left. If half of the two hundred women in our tribe have sons, and only sons, then one hundred mitochondrial lineages will dash against the glass pane of male-only heredity and vanish in the next generation. Another half will dead-end into male children in the second generation, and so forth. By the end of several generations, all the descendants of the tribe, male or female, might track their mitochondrial ancestry to just a few women. For modern humans, that number has reached one: each of us can trace our mitochondrial lineage to a single human female who existed in Africa about two hundred thousand years ago. She is the common mother of our species. We do not know what she looked like, although her closest modern-day relatives are women of the San tribe from Botswana or Namibia. I find the idea of such a founding mother endlessly mesmerizing. In human genetics, she is known by a beautiful name—Mitochondrial Eve.
”
”
Siddhartha Mukherjee (The Gene: An Intimate History)
“
Further expanding the already large class of Foucauldian apparatuses, I shall cal an apparatus literally anything that has in some way the capacity to capture, determine, intercept, model, control , or secure the gestures, behaviors, opinions, or discourses of living beings. Not only, therefore, prisons, madhouses, the panopticon, schools, confession, factories, disciplines, juridical measures, and so forth (whose connection with power is in a certain sense evident), but also the pen, writing, literature, philosophy, agriculture, cigarettes, navigation, computers, cellular telephones and - why not - language itself, which is perhaps the most ancient of apparatuses - one in which thousands and thousands of years ago a primitive inadvertently let himself be captured, probably without realizing the consequences that he was about to face.
”
”
Giorgio Agamben (What Is an Apparatus? and Other Essays)
“
Eating sugar in excess of what can be immediately burned causes it to be stored in the liver in the form of glucose (glycogen). Since the liver’s capacity is limited, a daily intake of refined sugar soon causes the liver to exceed its ability to store sugar, and the excess glycogen is returned to the blood in the form of fatty acids. These are taken to every part of the body and stored as fat in the most inactive areas: the belly, the buttocks, the breasts, and the thighs.
”
”
Raymond Francis (Never Be Fat Again: The 6-Week Cellular Solution to Permanently Break the Fat Cycle)
“
And I get angry. Because we've tried so hard. Ninety-six percent of Black women tried so hard in voting against him. And not only did this country not elect Clinton, it elected a person who publicly supported sexual assault, a man one accused of rape by his daughter Ivanka's mother. I am angry with the Democratic Party for not knowing that there could have been and should have been a better candidate and angry that a better campaign -- a campaign that honored the journey, that included community in real and transformative ways -- was not launched. I am angry I didn't realize -- or accept on a cellular level -- how wedded to racism and misogyny average Americans are. I am angry at my own naiveté. Our own naiveté. There was a real and substantive difference between these two candidates and we didn't take that seriously enough.
”
”
Patrisse Khan-Cullors (When They Call You a Terrorist: A Black Lives Matter Memoir)
“
Our memories are in part reconstructions. Whenever we retrieve a memory, the brain rewrites it a bit, updating the past according to our present concerns and understanding. At the cellular level, LeDoux explains, retrieving a memory means it will be “reconsolidated,” slightly altered chemically by a new protein synthesis that will help store it anew after being updated.40 Thus each time we bring a memory to mind, we adjust its very chemistry: the next time we retrieve it, that memory will come up as we last modified it. The specifics of the new consolidation depend on what we learn as we recall it. If we merely have a flare-up of the same fear, we deepen our fearfulness. But the high road can bring reason to the low. If at the time of the fear we tell ourselves something that eases its grip, then the same memory becomes reencoded with less power over us. Gradually, we can bring the once-feared memory to mind without feeling the rush of distress all over again. In such a case, says LeDoux, the cells in our amygdala reprogram so that we lose the original fear conditioning.41 One goal of therapy, then, can be seen as gradually altering the neurons for learned fear.
”
”
Daniel Goleman (Social Intelligence)
“
When you feel the need to escape your problems, to escape from this world, don't make the mistake of resorting to suicide Don't do it! You will hear the empty advice of many scholars in the matter of life and death, who will tell you, "just do it" there is nothing after this, you will only extinguish the light that surrounds you and become part of nothingness itself, so when you hear these words remember this brief review of suicide: When you leave this body after committing one of the worst acts of cowardice that a human being can carry out, you turn off the light, the sound and the sense of reality, you become nothing waiting for the programmers of this game to pick you up from the darkness, subtly erase your memories and enable your return and I emphasize the word subtle because sometimes the intelligence behind this maneuver or automated mechanism is wrong and send human beings wrongly reset to such an extent, that when they fall to earth and are born again, they begin to experience memories of previous lives, in many cases they perceive themselves of the opposite sex, and science attributes this unexplainable phenomenon to genetic and hormonal factors, but you and I know better! And we quickly identified this trigger as a glitch in the Matrix. Then we said! That a higher intelligence or more advanced civilization throws you back into this game for the purpose of experimenting, growing and developing as an advanced consciousness and due to your toxic and destructive behavior you come back again but in another body and another life, but you are still you, then you will carry with you that mark of suicide and cowardice, until you learn not to leave this experience without having learned the lesson of life, without having experienced and surprised by death naturally or by design of destiny. About this first experience you will find very little material associated with this event on the internet, it seems that the public is more reserved, because they perceive themselves and call themselves "awakened" And that is because the system has total control over the algorithm of fame and fortune even over life and death. Now, according to religion and childish fears, which are part of the system's business to keep you asleep, eyes glued to the cellular device all day, it says the following: If you commit this act of sin, you turn off light, sound and sense of reality, and from that moment you begin to experience pain, fear and suffering on alarming scales, and that means they will come for you, a couple of demons and take you to the center of the earth where the weeping and gnashing of teeth is forever, and in that hell tormented by demons you will spend eternity. About this last experience we will find hundreds of millions of people who claim to have escaped from there! And let me tell you that all were captivated by the same deity, one of dubious origin, that feeds on prayers and energetic events, because it is not of our nature, because it knows very well that we are beings of energy, then this deity or empire of darkness receives from the system its food and the system receives from them power, to rule, to administer, to control, to control, to kill, to exclude, to inhibit, to classify, to imprison, to silence, to infect, to contaminate, to depersonalize. So now that you know the two sides of the same coin, which one will your intelligence lean towards! You decide... Heads or tails? From the book Avatars, the system's masterpiece.
”
”
Marcos Orowitz (THE LORD OF TALES: The masterpiece of deceit)
“
Age, that brings a dwindling to most forms of life, is at its most majestic in the trees. I have seen living olives that were planted when Caesar was in Gaul. I remember, in Illinois woods, a burr oak which was bent over as a sapling a hundred years ago, to mark an Indian portage trail, and the thews in that flexed bough were still in the prime of life. Compared to that, the strongest human sinew is feeble and quick to decay. Yet structure in both cases is cellular; life in both is protoplasmic. A tree drinks water as I do, and breathes oxygen. There is the difference that it exhales more oxygen than it consumes, so that it sweetens the air where it grows. It lays the dust and tempers the wind. Even when it is felled, it but enters on a new kind of life. Sawn and seasoned and finished, it lays bare the hidden beauty of its heart, in figures and grains more lovely than the most premeditated design. It is stronger, now, than it was in the living tree, and may bear great strains and take many shapes.
”
”
Donald Culross Peattie (American Heartwood)
“
I feel as though dispossessed from the semblances of some crystalline reality to which I’d grown accustomed, and to some degree, had engaged in as a participant, but to which I had, nevertheless, grown inexplicably irrelevant. But the elements of this phenomenon are now quickly dissolving from memory and being replaced by reverse-engineered Random Access actualizations of junk code/DNA consciousness, the retro-coded catalysts of rogue cellular activity. The steel meshing titters musically and in its song, I hear a forgotten tale of the Interstitial gaps that form pinpoint vortexes at which fibers (quanta, as it were) of Reason come to a standstill, like light on the edge of a Singularity. The gaps, along their ridges, seasonally infected by the incidental wildfires in the collective unconscious substrata.
Heat flanks passageways down the Interstices. Wildfires cluster—spread down the base trunk Axon in a definitive roar: hitting branches, flaring out to Dendrites to give rise to this release of the very chemical seeds through which sentience is begotten.
Float about the ether, gliding a gentle current, before skimming down, to a skip over the surface of a sea of deep black with glimmering waves. And then, come to a stop, still inanimate and naked before any trespass into the Field, with all its layers that serve to veil. Plunge downward into the trenches. Swim backwards, upstream, and down through these spiraling jets of bubbles. Plummet past the threshold to trace the living history of shadows back to their source virus. And acquire this sense that the viruses as a sample, all of the outlying populations withstanding: they have their own sense of self-importance, too. Their own religion. And they mine their hosts barren with the utilitarian wherewithal that can only be expected of beings with self-preservationist motives.
”
”
Ashim Shanker (Sinew of the Social Species)
“
Where and How Can I Do Buying Textnow Account Online – Complete 2026's Guide + 10 Proven Tips
Egsmm.com is your ultimate destination to buy Textnow accounts, offering a diverse selection of both old and new accounts tailored to meet all your communication needs. Whether you’re seeking the reliability of established profiles with a rich history or the fresh appeal of newly created ones, we provide an array of options that ensure seamless connectivity. Our old Textnow accounts come pre-loaded with features that enhance user experience, making them perfect for anyone looking to dive into their messaging without delays.
At Egsmm.com, buying Textnow accounts is not just about acquiring a number; it’s about accessing a world where vibrant conversations flow effortlessly. Experience unparalleled convenience and security as you choose from our extensive inventory designed specifically for savvy users like you who demand quality and versatility in their texting solutions.
Contact Us for more Information’s:
✮⭐✮ 24/7 Customer Support
✮⭐✮✮⭐✮✮⭐✮✮⭐✮✮⭐✮✮⭐✮✮⭐✮✮⭐✮✮⭐✮
✮⭐✮Telegram:@usaallshop
✮⭐✮Whatsapp: +1(862)2933814
Best place to Buy Textnow Accounts
To buy TextNow accounts, visit reputable online marketplaces Egsmm.com. They specializing in digital accounts.
TextNow is a popular service offering free phone numbers and texting capabilities through its app. Many users seek to buy TextNow accounts for various purposes, including business communication, personal use, or bypassing SMS verifications. Finding a reliable seller is crucial to avoid scams and ensure account security.
Look for sellers with positive reviews and transparent transaction processes. Using a trusted marketplace can also add an extra layer of security. Always prioritize your privacy and security when purchasing digital accounts. Buying from reputable sources ensures a smooth and secure transaction, allowing you to enjoy the benefits of TextNow without any issues.
Introduction To Textnow And Its Uses
Textnow offers virtual phone numbers for calling and texting, ideal for personal or business use. Buy Textnow accounts to access affordable communication solutions and enhance connectivity.
TextNow is a popular communication app that offers free calling and texting services. It’s widely used for its convenience and cost-effectiveness. This section will delve into the various aspects of TextNow and its uses.
Contact Us for more Information’s:
Contact Us for more Information’s:
✮⭐✮ 24/7 Customer Support
✮⭐✮✮⭐✮✮⭐✮✮⭐✮✮⭐✮✮⭐✮✮⭐✮✮⭐✮✮⭐✮
✮⭐✮Telegram:@usaallshop
✮⭐✮Whatsapp: +1(862)2933814
What Is Textnow?
TextNow is a versatile app that allows users to make free phone calls and send texts. It uses VoIP (Voice over Internet Protocol) technology, which means it works over Wi-Fi or mobile data. TextNow provides a unique phone number, enabling users to communicate without relying on traditional cellular services.
Key Features Of Textnow
Here are some of the standout features of TextNow:
• Free Phone Number: Each user receives a dedicated phone number.
• Unlimited Calling and Texting: Offers free unlimited communication within the USA and Canada.
• Voicemail and Call Forwarding: Includes advanced features like voicemail and call forwarding.
• Multi-Platform Availability: Accessible on smartphones, tablets, and desktops.
Uses Of Textnow
TextNow serves various purposes, making it a handy tool for different scenarios:
• Personal Use: Ideal for staying in touch with friends and family.”
― Where and How Can I Do Buying Textnow Account Online – Complete 2026's Guide + 10 Proven Tips
”
”
Where and How Can I Do Buying Textnow Account Online – Complete 2026's Guide + 10 Proven Tips
“
The TVC universe will never collapse. Never. A hundred billion years, a hundred trillion; it makes no difference, it will always be expanding. Entropy is not a problem. Actually, ‘expanding’ is the wrong word; the TVC universe grows like a crystal, it doesn’t stretch like a balloon. Think about it. Stretching ordinary space increases entropy; everything becomes more spread out, more disordered. Building more of a TVC cellular automaton just gives you more room for data, more computing power, more order. Ordinary matter would eventually decay, but these computers aren’t made out of matter. There’s nothing in the cellular automaton’s rules to prevent them from lasting forever.
Durham’s universe - being made of the same “dust” as the real one, merely rearranged itself. The rearrangement was in time as well as space; Durham’s universe could take a point of space-time from just before the Big Crunch, and follow it with another from ten million years BC. And even if there was only a limited amount of “dust” to work with, there was no reason why it couldn’t be reused in different combinations, again and again. The fate of the TVC automaton would only have to make internal sense - and the thing would have no reason, ever, to come to an end.
”
”
Greg Egan (Permutation City)
“
and I am convinced that healthy emotional boundaries—such as being clear and vocal about what you will and will not let into your life—are what make relationships functional. Your gut lining is a boundary between you and everything else in the universe that is poised to inundate and overwhelm your biology and generate unrelenting inflammation. Healing and strengthening your gut lining with food—therefore creating and strengthening this critical boundary and reducing intestinal permeability or “leaky gut”—allows you to be selective about what you want to take in from the universe on a material level. You can choose what serves you. I reflect on the fact that many of the problems in society—including violence, mental illness, developmental issues, and pain—start in humans, and humans are made by cells that become dysfunctional largely because of oxidative stress, mitochondrial dysfunction, and chronic inflammation. How miraculous that food can directly combat those things. We can’t have a healthy society without well-functioning humans. We can’t have well-functioning humans without well-functioning cells. And we can’t have well-functioning cells with mitochondrial dysfunction, oxidative stress, chronic inflammation, and cellular and hormone disruption from toxic chemicals in our food. We combat those things through nutrient-dense, unprocessed foods grown in living, thriving soil.
”
”
Casey Means (Good Energy: The Surprising Connection Between Metabolism and Limitless Health)
“
Only the middle distance and what may be called the remoter foreground are strictly human. When we look very near or very far, man either vanishes altogether or loses his primacy. The astronomer looks even further afield than the Sung painter and sees even less of human life. At the other end of the scale the physicist, the chemist, the physiologist pursue the close-up – the cellular close-up, the molecular, the atomic and subatomic. Of that which, at twenty feet, even at arm’s length, looked and sounded like a human being no trace remains.
Something analogous happens to the myopic artist and the happy lover. In the nuptial embrace personality is melted down; the individual (it is the recurrent theme of Lawrence’s poems and novels) ceases to be himself and becomes a part of the vast impersonal universe.
And so it is with the artist who chooses to use his eyes at the near point. In his work humanity loses its importance, even disappears completely. Instead of men and women playing their fantastic tricks before high heaven, we are asked to consider the lilies, to meditate on the unearthly beauty of ‘mere things,’ when isolated from their utilitarian context and rendered as they are, in and for themselves. Alternatively (or, at an earlier stage of artistic development, exclusively), the nonhuman world of the near-point is rendered in patterns. These patterns are abstracted for the most part from leaves and flowers – the rose, the lotus, the acanthus, palm, papyrus – and are elaborated, with recurrences and variations, into something transportingly reminisce
”
”
Aldous Huxley (The Doors of Perception)
“
Competition is the spice of sports; but if you make spice the whole meal you'll be sick.
The simplest single-celled organism oscillates to a number of different frequencies, at the atomic, molecular, sub-cellular, and cellular levels. Microscopic movies of these organisms are striking for the ceaseless, rhythmic pulsation that is revealed. In an organism as complex as a human being, the frequencies of oscillation and the interactions between those frequencies are multitudinous. -George Leonard
Learning any new skill involves relatively brief spurts of progress, each of which is followed by a slight decline to a plateau somewhat higher in most cases than that which preceded it…the upward spurts vary; the plateaus have their own dips and rises along the way…To take the master’s journey, you have to practice diligently, striving to hone your skills, to attain new levels of competence. But while doing so–and this is the inexorable–fact of the journey–you also have to be willing to spend most of your time on a plateau, to keep practicing even when you seem to be getting nowhere. (Mastery, p. 14-15).
Backsliding is a universal experience. Every one of us resists significant change, no matter whether it’s for the worse or for the better. Our body, brain and behavior have a built-in tendency to stay the same within rather narrow limits, and to snap back when changed…Be aware of the way homeostasis works…Expect resistance and backlash. Realize that when the alarm bells start ringing, it doesn’t necessarily mean you’re sick or crazy or lazy or that you’ve made a bad decision in embarking on the journey of mastery. In fact, you might take these signals as an indication that your life is definitely changing–just what you’ve wanted….Be willing to negotiate with your resistance to change.
Our preoccupation with goals, results, and the quick fix has separated us from our own experiences…there are all of those chores that most of us can’t avoid: cleaning, straightening, raking leaves, shopping for groceries, driving the children to various activities, preparing food, washing dishes, washing the car, commuting, performing the routine, repetitive aspects of our jobs….Take driving, for instance. Say you need to drive ten miles to visit a friend. You might consider the trip itself as in-between-time, something to get over with. Or you could take it as an opportunity for the practice of mastery. In that case, you would approach your car in a state of full awareness…Take a moment to walk around the car and check its external condition, especially that of the tires…Open the door and get in the driver’s seat, performing the next series of actions as a ritual: fastening the seatbelt, adjusting the seat and the rearview mirror…As you begin moving, make a silent affirmation that you’ll take responsibility for the space all around your vehicle at all times…We tend to downgrade driving as a skill simply because it’s so common. Actually maneuvering a car through varying conditions of weather, traffic, and road surface calls for an extremely high level of perception, concentration, coordination, and judgement…Driving can be high art…Ultimately, nothing in this life is “commonplace,” nothing is “in between.” The threads that join your every act, your every thought, are infinite. All paths of mastery eventually merge.
[Each person has a] vantage point that offers a truth of its own.
We are the architects of creation and all things are connected through us.
The Universe is continually at its work of restructuring itself at a higher, more complex, more elegant level . . . The intention of the universe is evolution.
We exist as a locus of waves that spreads its influence to the ends of space and time.
The whole of a thing is contained in each of its parts.
We are completely, firmly, absolutely connected with all of existence.
We are indeed in relationship to all that is.
”
”
George Leonard
“
Jack coughed slightly and offered his hand. “Hi, uh. I’m Jack.”
Kim took it. “Jack what?”
“Huh?”
“Your last name, silly.”
“Jackson.”
She blinked at him. “Your name is Jack Jackson?”
He blushed. “No, uh, my first name’s Rhett, but I hate it, so…”
He gestured to the chair and she sat. Her dress rode up several inches, exposing pleasing long lines of creamy skin. “Well, Jack, what’s your field of study?”
“Biological Engineering, Genetics, and Microbiology. Post-doc. I’m working on a research project at the institute.”
“Really? Oh, uh, my apple martini’s getting a little low.”
“I’ve got that, one second.” He scurried to the bar and bought her a fresh one. She sipped and managed to make it look not only seductive but graceful as well.
“What do you want to do after you’re done with the project?” Kim continued.
“Depends on what I find.”
She sent him a simmering smile. “What are you looking for?”
Immediately, Jack’s eyes lit up and his posture straightened. “I started the project with the intention of learning how to increase the reproduction of certain endangered species. I had interest in the idea of cloning, but it proved too difficult based on the research I compiled, so I went into animal genetics and cellular biology. It turns out the animals with the best potential to combine genes were reptiles because their ability to lay eggs was a smoother transition into combining the cells to create a new species, or one with a similar ancestry that could hopefully lead to rebuilding extinct animals via surrogate birth or in-vitro fertilization. We’re on the edge of breaking that code, and if we do, it would mean that we could engineer all kinds of life and reverse what damage we’ve done to the planet’s ecosystem.”
Kim stared. “Right. Would you excuse me for a second?”
She wiggled off back to her pack of friends by the bar. Judging by the sniggering and the disgusted glances he was getting, she wasn’t coming back.
Jack sighed and finished off his beer, massaging his forehead. “Yes, brilliant move. You blinded her with science. Genius, Jack.”
He ordered a second one and finished it before he felt smallish hands on his shoulders and a pair of soft lips on his cheek. He turned to find Kamala had returned, her smile unnaturally bright in the black lights glowing over the room. “So…how did it go with Kim?”
He shot her a flat look. “You notice the chair is empty.”
Kamala groaned. “You talked about the research project, didn’t you?”
“No!” She glared at him.
“…maybe…”
“You’re so useless, Jack.” She paused and then tousled his hair a bit. “Cheer up. The night’s still young. I’m not giving up on you.”
He smiled in spite of himself. “Yet.”
Her brown eyes flashed. “Never.
”
”
Kyoko M. (Of Cinder and Bone (Of Cinder and Bone, #1))